Labshake search
Citations for Illumina :
501 - 550 of 9305 citations for Rat T Cell Surface Glycoprotein CD3 Gamma Chain CD3G ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2019Quote: ... using a MiniSeq High Output kit (Illumina). Total sequencing yielded 12.4 Gbp and generated between 0.73 Gbp and 1.49 Gbp per sample ...
-
bioRxiv - Microbiology 2019Quote: ... and sequencing using the MiSeq kit (Illumina) were performed by the Farncombe Metagenomics Facility at McMaster University (Canada) ...
-
bioRxiv - Cancer Biology 2019Quote: ... The Nextera XT Library Prep kit (Illumina) was used for library preparation ...
-
bioRxiv - Microbiology 2019Quote: ... using a V4 chemistry sequencing kit (Illumina). Reads were then processed to remove adapter sequences ...
-
bioRxiv - Genomics 2019Quote: ... with RiboZero depletion (Gold kit; Illumina, MRZG12324).
-
bioRxiv - Molecular Biology 2020Quote: ... Human Ribo-Zero rRNA depletion kit (Illumina). Paired-end 150+150 bp sequencing was done with Illumina NextSeq 500 using NextSeq 500/550 High Output Kit v2.5 for HeLa samples and with Illumina NovaSeq 6000 using partial S4 flow cell lane for patient samples.
-
bioRxiv - Neuroscience 2020Quote: ... with a Nextera XT DNA kit (Illumina). Libraries were multiplexed on two high-output flow cells and sequenced (75 bp reads ...
-
bioRxiv - Microbiology 2020Quote: ... V2x500 or V3x600 sequencing kits (Illumina, USA), always generating 283bp size amplicons suitable for analysis ...
-
bioRxiv - Microbiology 2021Quote: ... the ribozero Removal Kit was used (Illumina). The NEBNext Ultra II RNA Library Prep Kit (Illumina ...
-
bioRxiv - Neuroscience 2019Quote: ... Nextera XT DNA library Prep Kit (Illumina) were used to create cDNA libraries for sequencing ...
-
bioRxiv - Microbiology 2019Quote: ... rRNA was reduced (Ribo-Zero kit, Illumina), and a strand-specific library was prepared (TruSeq Stranded Total RNA Sample Prep Kit ...
-
bioRxiv - Microbiology 2019Quote: ... and the TruSeq Stranded mRNA kit (Illumina) was used to prepare poly(A ...
-
bioRxiv - Developmental Biology 2019Quote: ... and TruSeq ChIP Sample Prep kit (Illumina) per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... barcoded by using the Nextera kit (Illumina), and pooled in one lane of an Illumina HiSeq2500 for sequencing ...
-
bioRxiv - Genomics 2021Quote: ... using TruSeq SBS Kit v4 reagents (Illumina). The RNA-seq experiment was performed in two replicates for each sample distributed across 8 lanes ...
-
bioRxiv - Genomics 2021Quote: ... with a NextSeq High Output kit (Illumina) platform with 2 x 150 read length.
-
bioRxiv - Immunology 2021Quote: ... TruSeq stranded mRNA Library prep kit (Illumina) and Truseq RNA Unique Dual Indexed Adapters (Illumina ...
-
bioRxiv - Neuroscience 2021Quote: ... the TruSeq stranded RNA kit (Illumina Inc.) was used according to the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2021Quote: ... the TruSeq stranded RNA kit (Illumina Inc.) was used according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: The Nextera DNA Library Prep Kit (Illumina) was used to prepare sequence libraries with 25 ng of input DNA ...
-
bioRxiv - Genomics 2020Quote: ... RNA Library Prep Kit v2 from Illumina® (Illumina Inc. ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using the TruSeq stranded mRNA kit (Illumina) to enrich for polyadenylated transcripts ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... mid Output 150 cycles kits (Illumina®) for 2 × 75 bp PE reads ...
-
bioRxiv - Microbiology 2021Quote: ... the Ribo-Zero rRNA removal kit (Illumina) was used without deviations from the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... using a MiSeq v3 Reagent Kit (Illumina) and 2 × 300 bp paired end sequencing ...
-
bioRxiv - Immunology 2021Quote: ... using the v3 MiSeq Reagent Kit (Illumina). 16S data were analyzed using QIIME 2 (3) ...
-
bioRxiv - Molecular Biology 2021Quote: ... TruSeq SBS Kit v3-HS (Illumina, USA).
-
bioRxiv - Immunology 2020Quote: ... with the Ribo-Zero Gold kit (Illumina) for ribosomal depletion ...
-
bioRxiv - Immunology 2020Quote: ... employing Illumina MiSeq v2 Reagent Kit (Illumina). For the analysis of TCR sequencing data ...
-
bioRxiv - Immunology 2020Quote: ... Indices from the Nextera Index Kit (Illumina), followed by adaptors P1 (AATGATACGGCGACCACCGA ...
-
bioRxiv - Microbiology 2021Quote: ... with HiSeq Rapid SBS kit v2 (Illumina), generating paired-end reads up to 250 bp ...
-
bioRxiv - Genetics 2019Quote: ... and Index Kit (Illumina FC-131-1001), according to the standard manufacturer protocol ...
-
bioRxiv - Genomics 2021Quote: ... purified for library preparation (Illumina Library Kit), and deep-sequencing with 200 million tags through Illumina HiSeq2500 sequencer.
-
bioRxiv - Genomics 2021Quote: ... rRNA was depleted using RiboZero kit (Illumina). NGS-libraries were generated using NEBnext Ultra II directional RNA library prep kit for Illumina and sequenced as PE75 reads on an Illumina NextSeq550.
-
bioRxiv - Genomics 2021Quote: KAPA Hyper Prep Kits from Illumina (KK8500) were used to construct the library with a slight modification to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... using the TruSeq SBS Kit v3 (Illumina). An average of 40 million paired reads were generated per sample ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2.5μl Transposase enzyme (Illumina Nextera kit, 15028252) and 22.5μl Nuclease-free water in a total of 50uL reaction for 1 hour at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... TruSeq Stranded mRNA Library Prep kit (Illumina) was used to assess transcript abundance following standard instructions from the manufacturer ...
-
bioRxiv - Neuroscience 2022Quote: ... the TruSeq stranded RNA kit (Illumina Inc.) was used according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... The Kapa Hyper Prep kit (for Illumina) was used for sequencing library preparation ...
-
bioRxiv - Microbiology 2022Quote: ... Multiplexing Sample Preparation Oligonucleotide Kit from Illumina, Inc ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and Nextera XT index kit D (Illumina). Amplicon sizes were verified on a Tapestation using the High Sensitivity D1000 Screentape (Agilent) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Ribo-Zero rRNA removal kit (Illumina). After purifying RNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... tagmentation (Nextera DNA Sample Preparation Kit, Illumina) and library preparation was performed ...
-
bioRxiv - Neuroscience 2022Quote: ... The TruSeq RNA Sample Prep Kit (Illumina) was used for library preparation from all samples ...
-
bioRxiv - Immunology 2023Quote: ... and Nextera XT library prep kit (Illumina) with an input of 10ng of RNA per sample ...
-
bioRxiv - Microbiology 2023Quote: ... using TruSeq SBS Kit v3 - HS (Illumina) for 50 cycles ...
-
bioRxiv - Genomics 2023Quote: The Nextera XT Index Kit (Illumina inc.) was used to construct the libraries ...
-
bioRxiv - Microbiology 2023Quote: ... using a MiSeq Reagent kit v3 (Illumina) following the standard guidelines for preparing and loading samples on the MiSeq ...
-
bioRxiv - Neuroscience 2023Quote: ... and purified with a RiboZero kit (Illumina). The resulting mRNA fragment inserts were then reverse transcribed to first strand cDNA using reverse transcriptase and random primer in the presence of actinomycin D ...