Labshake search
Citations for Illumina :
501 - 550 of 678 citations for Potassium Bromate 90 95% Chemical Purity 18O3 98% 100 Ug Ml In 18O Water since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... Hand > MblRNAi;HA-UPRT and Hand > Bru3;HA-UPRT RNA fractions were mixed at equal concentrations and sequenced (100-bp paired-end reads) on the same lane of a HiSeq 2000 (EMBL Gene Core Illumina Sequencing facility ...
-
bioRxiv - Immunology 2020Quote: ... and sequenced across 75 or 100 bp using a paired-end strategy on a NextSeq 550 or a HiSeq4000 (Illumina). One or two biological replicates were sequenced per experiment.
-
bioRxiv - Systems Biology 2019Quote: ... The resulting directional RNA-seq libraries were sequenced using single-end 100-nt read chemistry on an Illumina HiSeq 2500 platform (Illumina) at the Lausanne Genomic Technologies Facility.
-
bioRxiv - Genomics 2021Quote: ... [140] with parameters “2 7 7 80 10 100 2000 -ngs -h”. We also used kseek to search for tandem repeats in the male Illumina reads.
-
bioRxiv - Systems Biology 2021Quote: ... The resulting pools were loaded into NovaSeq Reagent cartridges for 100-cycle single-read analysis and sequenced with a NovaSeq6000 following the manufacturer’s recommended protocol (Illumina Inc.).
-
bioRxiv - Cancer Biology 2021Quote: ... The resulting pool was loaded into 200cycle NovaSeq Reagent cartridge for 2×100 sequencing and sequenced on a NovaSeq6000 following the manufacturer’s recommended protocol (Illumina Inc.).
-
bioRxiv - Immunology 2020Quote: ... Indexed samples were pooled together for 100 cycles of paired end sequencing on a HiSeq 4000 or HiSeq 2500 system (Illumina). More than 40 million reads per sample were sequenced for downstream analysis.
-
bioRxiv - Genomics 2021Quote: ... The final libraries containing barcoded single-cell transcriptomes were sequenced at 100 cycles using the S2 flowcell on the Novoseq 6000 system (Illumina).
-
Glycogen Synthase Kinase 3 regulates the genesis of the rare displaced ganglion cell retinal subtypebioRxiv - Neuroscience 2021Quote: ... Stranded RNA-Seq libraries were constructed from 100 ng high-quality total RNA (RIN > 8) using the TruSeq Stranded mRNA Library Preparation Kit (Illumina). Paired-end sequencing of 40 bases length was performed on a NextSeq 500 system (Illumina) ...
-
bioRxiv - Immunology 2022Quote: ... The libraries were sequenced for 50 or 100 cycles (paired-end read) with a HiSeq 3000 or NovaSeq 6000 (Illumina).
-
bioRxiv - Cancer Biology 2022Quote: ... 100 ng of RNA input was used for cDNA library preparation using the TruSeq® Stranded mRNA NeoPrep kit (Illumina), according to manufacturer instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Library preparation was performed with 100 ng of DNA input using the TruSeq DNA Nano kit (Illumina, San Diego, USA) according to the manufacturers’ instructions ...
-
bioRxiv - Genomics 2022Quote: ... Samples were sequenced with a coverage of 50 M paired end reads (2 x 100 bp) /sample on a NovaSeq (Illumina).
-
bioRxiv - Genomics 2022Quote: ... Sequencing libraries were prepared from 100 ng of purified total RNA for biological replicates using TruSeq stranded Total RNA Library Prep (Illumina). Libraries were sequenced on the Illumina HiSeq (50 cycles ...
-
bioRxiv - Neuroscience 2023Quote: ... Isolated RNA was chemically degraded into fragments of approximately 100 nucleotides in length using fragmentation buffer (Illumina, Inc., CA, USA). A Magna MeRIP™ m1A Kit (Merck Millipore ...
-
bioRxiv - Neuroscience 2022Quote: ... The indexed libraries were then subjected to paired-end (2×100 bp) sequencing on the Illumina NovaSeq platform (Illumina, Inc.) by Macrogen Incorporated.
-
bioRxiv - Developmental Biology 2022Quote: ... Barcoded cDNA libraries were multiplexed onto a TruSeq paired-end flow cell and sequenced (100-bp paired-end reads) with a TruSeq 200-cycle SBS kit (Illumina). Samples were run on an Illumina NovaSeq 6000 sequencer at the KUMC Genome Sequencing Facility ...
-
bioRxiv - Immunology 2022Quote: ... Sequencing was performed in paired-end mode with a S1 and S2 flow cell (100 cycles) using NovaSeq 6000 sequencer (Illumina) at NCCT ...
-
bioRxiv - Cell Biology 2022Quote: ... A library of 350-800 bp length was run on a NovaSeq 6000 using NovaSeq 6000 SP Reagent Kit 100 cycles (ref #20027464, Illumina) with 17*-8-105* cycles reads.
-
bioRxiv - Immunology 2022Quote: ... Sequencing was performed to generate paired-end reads (2 × 100 bp) with a 200-cycle S1 flow cell on a NovaSeq 6000 sequencing system (Illumina).
-
bioRxiv - Cancer Biology 2022Quote: ... The resulting pool was loaded into the appropriate NovaSeq Reagent cartridge for 100-cycle paired-end sequencing and run on a NovaSeq6000 following the manufacturer’s recommended protocol (Illumina Inc.). Sequencing quality control was assessed using FASTQC v0.11.5 (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) ...
-
bioRxiv - Immunology 2022Quote: ... All Fast-ATAC libraries were sequenced using a 2×100 bp paired-end protocol on the HiSeq 4000 Sequencing System (Illumina).
-
bioRxiv - Genomics 2023Quote: ... The CUT&Tag libraries were subjected to 50bp paired end sequencing on a NextSeq 2000 platform using a P2 100-cycle kit (Illumina). Antibodies are listed in Key Resources Table.
-
bioRxiv - Cancer Biology 2023Quote: ... The resulting cDNA library was sequenced on an Illumina NovaSeq 6000 using the S1 100 cycle Reagent Kit v1.5 (Illumina 200228319), with a targeted read depth of 20,000 reads/cell.
-
bioRxiv - Neuroscience 2023Quote: ... The uniquely barcoded libraries were multiplexed onto one lane and 100-bp paired-end deep sequencing was carried out at the HiSeq 4000 (Illumina) generating ∼20 million reads per sample.
-
bioRxiv - Microbiology 2023Quote: ... was depleted and cDNA libraries were prepared from 100 ng total RNA by Stranded Total RNA Prep Ligation with Ribo-Zero Plus (Illumina). The quantity and quality of the prepared library were analyzed by the Qubit dsDNA BR Assay Kit and the Agilent 2100 Bioanalyzer using a DNA 1000 Kit ...
-
bioRxiv - Molecular Biology 2023Quote: ... we used one lane of a NovaSeq 6000 SP Reagent Kit v1.5 (100 cycles) (Illumina, San Diego, CA, USA, 20028401) (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... and values ≥7.5 were used for library preparation and paired-end (2 × 100 bp) RNA-sequencing on an Illumina NextSeq 6000 instrument (Illumina). Libraries were prepared using a Kapa RNA HyperPrep kit with ribosomal reduction ...
-
bioRxiv - Developmental Biology 2023Quote: ... 100 cycle sequencing kit (v1.5) to a minimum depth of 50K reads per cell (Illumina Inc., San Diego, CA, USA). Base calling was done by Illumina RTA3 and output was demultiplexed and converted to FastQ format with Cell Ranger (10X Genomics ...
-
bioRxiv - Genomics 2023Quote: ... The pooled RNA-seq libraries were subjected to two rounds of 50 bp paired end sequencing on a NextSeq 550 platform using a P2 100-cycle kit (Illumina).
-
bioRxiv - Systems Biology 2023Quote: ... The NGS libraries were pooled and sequenced as single-read with the custom sequencing primer provided with the QuantSeq NGS library preparation kit with 100 cycles on a HiSeq2000 sequencer (Illumina).
-
bioRxiv - Bioengineering 2023Quote: ... Pools were sequenced with 100 cycle run kits (28bp Read1, 8bp Index1 and 91bp Read2) on the NovaSeq 6000 Sequencing System (Illumina). Cell Ranger Single Cell Software was used to perform de-multiplexing ...
-
bioRxiv - Genetics 2023Quote: ... Libraries were then pooled and sequenced at The Jackson Laboratory using a 100 bp paired-end process on a HiSeq 2500 (Illumina) sequencing system (RRID:SCR_016383 ...
-
bioRxiv - Genomics 2023Quote: ... was isolated from 100 ng of total RNA followed by RNAseq library preparation using TruSeq Stranded mRNA Library Preparation Kit (Illumina). The sequencing runs were performed on a HiSeq4000 (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... and the 10x Genomics recommended sequencing parameters were used to run on the Novaseq S4 kit (PE 100) (Illumina Inc.).
-
bioRxiv - Evolutionary Biology 2023Quote: ... We prepared short-insert (350 bp) paired-end (PE) libraries from 100 ng of gDNA using a TruSeq Nano DNA LT Library Preparation Kit (Illumina) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The pooled libraries were loaded onto a NovaSeq 6000 sequencer at 300 pM final concentration for 100 bp paired-end sequencing (Illumina). Approximately 40 million reads per library was generated ...
-
bioRxiv - Microbiology 2023Quote: ... and RNA sequencing to a depth of 10 million 75 bp or 100 bp single end reads using a Nextseq500 or NextSeq2000 sequencing system (Illumina). Data were analysed using CLC Genomics Workbench version 21.0.5 (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: ... and were subsequently sequenced at paired-end 150 bp (DNA libraries) and paired-end 100 bp (RNA derived libraries) on a NovaSeq X Plus (Illumina) platform.
-
bioRxiv - Cancer Biology 2023Quote: ... The 100-cycle paired end sequencing run was performed using a NovaSeq 6000 S1 Reagent Kit v1.5 200 cycle (Illumina 20028318). Sequence data was converted to fastq files ...
-
bioRxiv - Immunology 2023Quote: ... 8 cycles for i7 index and 61 cycles for read 2) with Novaseq S2 flow cells (100 cycles) using Novaseq 6000 sequencer (Illumina) in the Life and Brain Center ...
-
bioRxiv - Cancer Biology 2023Quote: We generated RNA-seq data from the H1299 non-small cell lung cancer cell line with 108,321,106 reads (TrueSeq RNA v2 100 bp paired-end library and Illumina HiSeq2500 machine from Illumina, CA, USA). rTea was run on the RNA-seq data ...
-
bioRxiv - Cancer Biology 2023Quote: ... Equimolar multiplexed libraries were then sequenced using 100 or 150 bp paired-end runs on HiSeq 4000 or NovaSeq 6000 S4 platforms (Illumina) at the DKFZ Genomics and Proteomics Core Facility ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.8 µl 100 µM barcoded CRISPR KO primer (oMCB1440, aatgatacggcgaccaccgagatctacacGATCGGAAGAGCACAC GTCTGAACTCCAGTCAC NNNNNN CGACTCGGTGCCACTTTTTC, where NNNNNN is an Illumina TruSeq index), and 69.4 µl nuclease-free water were added to the 5 µl PCR1 reaction ...
-
bioRxiv - Developmental Biology 2023Quote: ... Barcoded cDNA libraries were multiplexed onto a TruSeq paired-end flow cell and sequenced (100-bp paired-end reads) with a TruSeq 200-cycle SBS kit (Illumina). Samples were run on an Illumina NovaSeq 6000 sequencer at the KUMC Genome Sequencing Facility ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were multiplexed and sequenced using P2 and P3 (100 Cycles) reagents on a NextSeq 2000 device (Illumina, Table 1S). Sequencing data was demultiplexed and converted to FASTQ format using bcl2fastq2 v2.20 (Illumina ...
-
bioRxiv - Developmental Biology 2024Quote: ... Barcoded cDNA libraries were multiplexed onto a TruSeq paired-end flow cell and sequenced (100-bp paired-end reads) with a TruSeq 200-cycle SBS kit (Illumina). Samples were run on Illumina HiSeq2500 sequencers located at the KUMC Genome Sequencing Facility ...
-
bioRxiv - Immunology 2024Quote: ... The sequencing was performed on an Illumina NovaSeq using S1 and S2 100 cycle kits (Illumina, San Diego, CA, USA) with specific dimensions (67 × 8 × 50 bp).
-
bioRxiv - Microbiology 2024Quote: ... Paired-end (100 bp) sequencing of each RNA library was performed on a HiSeq 2500 sequencing platform (Illumina, CA, USA).
-
bioRxiv - Evolutionary Biology 2021Quote: ... libraries were sequenced using 100 base-length read chemistry in paired-end flow cell on the Illumina HiSeq2000 (Illumina®, USA).