Labshake search
Citations for Illumina :
501 - 550 of 651 citations for Aminomethylphosphonic Acid 13C 99%;15N 98%;Methylene D2 98% 100 Ug Ml H2O since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... we used one lane of a NovaSeq 6000 SP Reagent Kit v1.5 (100 cycles) (Illumina, San Diego, CA, USA, 20028401) (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... and values ≥7.5 were used for library preparation and paired-end (2 × 100 bp) RNA-sequencing on an Illumina NextSeq 6000 instrument (Illumina). Libraries were prepared using a Kapa RNA HyperPrep kit with ribosomal reduction ...
-
bioRxiv - Developmental Biology 2023Quote: ... 100 cycle sequencing kit (v1.5) to a minimum depth of 50K reads per cell (Illumina Inc., San Diego, CA, USA). Base calling was done by Illumina RTA3 and output was demultiplexed and converted to FastQ format with Cell Ranger (10X Genomics ...
-
bioRxiv - Genomics 2023Quote: ... The pooled RNA-seq libraries were subjected to two rounds of 50 bp paired end sequencing on a NextSeq 550 platform using a P2 100-cycle kit (Illumina).
-
bioRxiv - Systems Biology 2023Quote: ... The NGS libraries were pooled and sequenced as single-read with the custom sequencing primer provided with the QuantSeq NGS library preparation kit with 100 cycles on a HiSeq2000 sequencer (Illumina).
-
bioRxiv - Bioengineering 2023Quote: ... Pools were sequenced with 100 cycle run kits (28bp Read1, 8bp Index1 and 91bp Read2) on the NovaSeq 6000 Sequencing System (Illumina). Cell Ranger Single Cell Software was used to perform de-multiplexing ...
-
bioRxiv - Genetics 2023Quote: ... Libraries were then pooled and sequenced at The Jackson Laboratory using a 100 bp paired-end process on a HiSeq 2500 (Illumina) sequencing system (RRID:SCR_016383 ...
-
bioRxiv - Genomics 2023Quote: ... was isolated from 100 ng of total RNA followed by RNAseq library preparation using TruSeq Stranded mRNA Library Preparation Kit (Illumina). The sequencing runs were performed on a HiSeq4000 (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... and the 10x Genomics recommended sequencing parameters were used to run on the Novaseq S4 kit (PE 100) (Illumina Inc.).
-
bioRxiv - Evolutionary Biology 2023Quote: ... We prepared short-insert (350 bp) paired-end (PE) libraries from 100 ng of gDNA using a TruSeq Nano DNA LT Library Preparation Kit (Illumina) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The pooled libraries were loaded onto a NovaSeq 6000 sequencer at 300 pM final concentration for 100 bp paired-end sequencing (Illumina). Approximately 40 million reads per library was generated ...
-
bioRxiv - Microbiology 2023Quote: ... and RNA sequencing to a depth of 10 million 75 bp or 100 bp single end reads using a Nextseq500 or NextSeq2000 sequencing system (Illumina). Data were analysed using CLC Genomics Workbench version 21.0.5 (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: ... and were subsequently sequenced at paired-end 150 bp (DNA libraries) and paired-end 100 bp (RNA derived libraries) on a NovaSeq X Plus (Illumina) platform.
-
bioRxiv - Cancer Biology 2023Quote: ... The 100-cycle paired end sequencing run was performed using a NovaSeq 6000 S1 Reagent Kit v1.5 200 cycle (Illumina 20028318). Sequence data was converted to fastq files ...
-
bioRxiv - Immunology 2023Quote: ... 8 cycles for i7 index and 61 cycles for read 2) with Novaseq S2 flow cells (100 cycles) using Novaseq 6000 sequencer (Illumina) in the Life and Brain Center ...
-
bioRxiv - Cancer Biology 2023Quote: We generated RNA-seq data from the H1299 non-small cell lung cancer cell line with 108,321,106 reads (TrueSeq RNA v2 100 bp paired-end library and Illumina HiSeq2500 machine from Illumina, CA, USA). rTea was run on the RNA-seq data ...
-
bioRxiv - Cancer Biology 2023Quote: ... Equimolar multiplexed libraries were then sequenced using 100 or 150 bp paired-end runs on HiSeq 4000 or NovaSeq 6000 S4 platforms (Illumina) at the DKFZ Genomics and Proteomics Core Facility ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.8 µl 100 µM barcoded CRISPR KO primer (oMCB1440, aatgatacggcgaccaccgagatctacacGATCGGAAGAGCACAC GTCTGAACTCCAGTCAC NNNNNN CGACTCGGTGCCACTTTTTC, where NNNNNN is an Illumina TruSeq index), and 69.4 µl nuclease-free water were added to the 5 µl PCR1 reaction ...
-
bioRxiv - Developmental Biology 2023Quote: ... Barcoded cDNA libraries were multiplexed onto a TruSeq paired-end flow cell and sequenced (100-bp paired-end reads) with a TruSeq 200-cycle SBS kit (Illumina). Samples were run on an Illumina NovaSeq 6000 sequencer at the KUMC Genome Sequencing Facility ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were multiplexed and sequenced using P2 and P3 (100 Cycles) reagents on a NextSeq 2000 device (Illumina, Table 1S). Sequencing data was demultiplexed and converted to FASTQ format using bcl2fastq2 v2.20 (Illumina ...
-
bioRxiv - Developmental Biology 2024Quote: ... Barcoded cDNA libraries were multiplexed onto a TruSeq paired-end flow cell and sequenced (100-bp paired-end reads) with a TruSeq 200-cycle SBS kit (Illumina). Samples were run on Illumina HiSeq2500 sequencers located at the KUMC Genome Sequencing Facility ...
-
bioRxiv - Immunology 2024Quote: ... The sequencing was performed on an Illumina NovaSeq using S1 and S2 100 cycle kits (Illumina, San Diego, CA, USA) with specific dimensions (67 × 8 × 50 bp).
-
bioRxiv - Microbiology 2024Quote: ... Paired-end (100 bp) sequencing of each RNA library was performed on a HiSeq 2500 sequencing platform (Illumina, CA, USA).
-
bioRxiv - Evolutionary Biology 2021Quote: ... libraries were sequenced using 100 base-length read chemistry in paired-end flow cell on the Illumina HiSeq2000 (Illumina®, USA).
-
bioRxiv - Neuroscience 2022Quote: 100 ng of total RNA was used to generate RNA-seq libraries using Illumina TruSeq stranded mRNA LT kit (Illumina, 20020594), following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was extracted and sequence reads (100 bp paired-end) were generated with Illumina TruSeq high output version 3 chemistry on a HiSeq 2500 (Illumina, Inc.) at NRC-Plant Biotechnology Institute (NRC-PBI) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10μL 2xTagment DNA buffer and 1μL of 100-fold in molecular-grade water diluted DNA tagmentation enzyme (Illumina 20034197, lot 20464427) were added to each 1μL input ...
-
bioRxiv - Physiology 2020Quote: ... All libraries were prepared from 100 to 200 pg of cDNA using the Nextera XT Kit (Illumina, San Diego, California, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... The Hi-C libraries were sent to the Australian Genome Research Facility (Melbourne, Australia) for sequencing using one lane of 100 bp PE sequencing using a HiSeq2000 (Illumina Inc.).
-
bioRxiv - Microbiology 2019Quote: ... The viral DNA was used to generate a 2×100 bp Illumina sequencing library and this was sequenced on a Illumina HiSeq4000 (Illumina, USA) at Macrogen Inc ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were diluted and pooled with 300 pM of each library and sequenced (100 bp, paired-end) on a NovaSeq (Illumina, USA). Samples were divided across two sequencing runs.
-
bioRxiv - Bioengineering 2020Quote: ... rRNA was removed from 100 ng of total RNA using Ribo-Zero(TM) rRNA Removal Kit (Illumina Biotechnology, San Diego, CA). Stranded cDNA libraries were generated using the Illumina Truseq Stranded mRNA Library Prep kit ...
-
Impairment of a distinct cancer-associated fibroblast population limits tumour growth and metastasisbioRxiv - Cancer Biology 2020Quote: ... mice were injected intraperitoneally with 150 mg kg−1 D-luciferin (Caliper Life Sciences) in 100 μL and mice imaged in vivo using an IVIS imaging chamber (IVIS Illumina II). Luminescence measurements (photons/second/cm2 ...
-
“A Proteogenomic workflow reveals distinct molecular phenotypes related to breast cancer appearance”bioRxiv - Systems Biology 2020Quote: ... A total of 100 ng of RNA input was then used for cDNA library preparation using the TruSeq® Stranded mRNA NeoPrep kit (Illumina), according to manufacturer instructions ...
-
bioRxiv - Microbiology 2022Quote: ... and sequenced on an Illumina NovaSeq using single-end 1×100 reads with the Illumina NovaSeq SP reagent kit (Illumina, 20027464). A total of 122,190,150 raw sequence reads (mean of 4,213,453 per sample (n = 29 ...
-
bioRxiv - Microbiology 2021Quote: Protocols for preparing samples for sequencing were specifically designed for the Illumina iSeq 100 System (Illumina Inc., San Diego, CA, USA), a portable ...
-
bioRxiv - Neuroscience 2021Quote: ... Sequencing libraries were generated from 100 ng of total RNA using the TruSeq RNA Sample Preparation kit (Illumina RS-122-2303) and quantified using the Qubit fluorometer (Life Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... Sequencing libraries were constructed from 100-1,000 ng of total RNA using the TruSeq total stranded mRNA Library Prep Kit (Illumina, San Diego). Library concentrations were assessed using a Qubit dsDNA BR Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2022Quote: ... The resulting cDNAs were subjected to 100 base paired-end sequencing on the Illumina HiSeq2500 Platform (Illumina, San Diego, CA, USA) (Matsumoto et al. ...
-
bioRxiv - Genomics 2022Quote: ... pH 7.4, 5 mM MgCl2, 10% dimethyl formamide, 0.33x PBS, 0.01% digitonin, 0.1% Tween-20, 100 nM Illumina Tn5 Transposase (Illumina, 20034197)) ...
-
bioRxiv - Genomics 2019Quote: ... BS-seq libraries were sequenced by 100 bp paired-end reads on the Illumina HiSeq-2500 (Illumina, San Diego, California, USA).
-
bioRxiv - Genomics 2019Quote: Libraries were prepared using NexteraXT and paired-end sequenced on the MiSeq (v3, 2×300 cycles) or iSeq 100 (I1, 2×150 cycles) platforms according to manufacturer instructions (Illumina Inc). All sequences were deposited in the SRA under accession number PRJNA561185.
-
bioRxiv - Plant Biology 2019Quote: ... 100 µL of the lysate described above was treated with 100 units of nuclease (provided in the TruSeq Mammalian Ribo Profile Kit, Illumina RPHMR12126) per 40 µg of RNA with gentle shaking at room temperature for one hour ...
-
bioRxiv - Genomics 2021Quote: Custom RNA capture-based libraries were prepared starting from 8.5 μL eluate for biofluid samples and 100 ng RNA for FFPE and MAQCA/B using the TruSeq RNA Exome Library Prep Kit (Illumina, USA). Library preparation happened according to the manufacturer’s protocol with some minor modifications ...
-
bioRxiv - Genomics 2021Quote: ... Each library was sequenced using 100 base-length read chemistry on a paired-end flow cell on the Illumina HiSeq2000 (Illumina, USA).
-
bioRxiv - Evolutionary Biology 2021Quote: Sequencing libraries were prepared from 100 ng DNA using the TruSeq Nano DNA sample preparation kit (cat# 20015964/5, Illumina Inc.) targeting an insert size of 350bp ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: The paired-end libraries were sequenced by 200 cycles (2 × 100 bp) using the HiSeq 2500 (Illumina, San Diego, CA, USA). Reads were generated in FASTQ format using the conversion software bcl2fastq2 (Illumina ...
-
bioRxiv - Developmental Biology 2021Quote: ... Illumina library construction and sequencing with 100 bp paired-end reads on the Illumina HiSeq2000 platform (Illumina, Inc., San Diego, CA) were carried out at the Genome Center of the Max Planck Institute for Plant Breeding Research (Cologne) ...
-
bioRxiv - Cancer Biology 2023Quote: Mice were injected intraperitoneally with 150 mg kg-1 D-luciferin (Caliper Life Sciences) in 100 μL and mice imaged in vivo using an IVIS imaging chamber (IVIS Illumina II). Luminescence measurements (photons per second per cm2 ...
-
bioRxiv - Biophysics 2023Quote: ... 100-120 μl pooled-denatured 20 pM library and 10-20 μl 20 pM PhiX control library (Illumina, FC-110-3001) to provide a reasonable spot density in general ...