Labshake search
Citations for Illumina :
501 - 550 of 2140 citations for 8 Benzyloxy 5 R 2 bromo 1 hydroxyethyl 1H quinolinone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... Paired end reads (2×100bp) were obtained using the HiSeq 4000 (Illumina).
-
bioRxiv - Microbiology 2021Quote: To process the bacterial sequencing data (Illumina Miseq©, 2*250 bp), we used the FROGS pipeline [15] ...
-
bioRxiv - Microbiology 2022Quote: ... and sequenced using 2×300 bp reads on a MiSeq instrument (Illumina).
-
bioRxiv - Cancer Biology 2022Quote: ... Libraries were sequenced using 2×150 cycles on a NovaSeq 6000 (Illumina).
-
bioRxiv - Cancer Biology 2022Quote: ... Libraries were sequenced using 2×150 cycles on a NovaSeq 6000 (Illumina).
-
bioRxiv - Developmental Biology 2022Quote: ... paired-end (2 × 150 bp) sequencing on a NovaSeq 6000 platform (Illumina). Raw sequence reads were processed using an in-house developed pipeline ...
-
bioRxiv - Cancer Biology 2022Quote: ... Paired-end 2×50 bp sequencing performed using a HiSeq2500 system (Illumina). Data quality control performed using FastQC v0.11.8 ...
-
bioRxiv - Cell Biology 2022Quote: ... Library preparation (NexteraXT kit) and paired-end sequencing (Illumina HiSeq, 2×150bp) was performed by Azenta Life Sciences (Indianapolis ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 x 150 pair-end sequencing was performed using the HiSeq2500 (Illumina) with recommended protocol ...
-
bioRxiv - Genomics 2020Quote: ... with the respiratory virus oligo panel including SARS-CoV-2 probes (Illumina, San Diego ...
-
bioRxiv - Developmental Biology 2020Quote: ... and paired end-sequenced (2×75 bp) on the HiSeq 2500 (Illumina). Experiment 1 ...
-
bioRxiv - Developmental Biology 2020Quote: ... The sequencing was outsourced (GENEWIZ Illumina NovaSeq/HiSeq 2×150 bp sequencing), generating a 20 million paired-end reads per replicate ...
-
bioRxiv - Immunology 2020Quote: ... using 2 × 300 bp paired-end kits (Illumina MiSeq Reagent Kit v3). Sequence analysis and assembly of lineage trees were performed using an in-house custom analysis pipeline as previously described (39 ...
-
bioRxiv - Developmental Biology 2022Quote: ... followed by the addition of 25 µl of 2× TD buffer (Illumina) and 7.5 µl of Nextra Tn5 transposase (Illumina) ...
-
bioRxiv - Microbiology 2022Quote: ... SARS-CoV-2 stocks were deep sequenced on a MiSeq platform (Illumina). SARS-CoV-2 whole-genome amplicon-based sequencing was conducted by adapting an existing whole genome sequencing pipeline for poliovirus genotyping as described (Wang et al. ...
-
bioRxiv - Immunology 2022Quote: ... with the NextSeq 500/550 High Output 2×75 cycles kit (Illumina). All sequenced samples were quality assessed by capillary electrophoresis with the Agilent RNA 2100 Nano kit (Bioanalyzer ...
-
bioRxiv - Microbiology 2023Quote: ... The retained libraries were sequenced using MiSeq V3 (2 × 300 bp) (Illumina).
-
bioRxiv - Microbiology 2023Quote: ... version 3 (2×300 bp read length; Illumina, San Diego, CA, USA).
-
bioRxiv - Systems Biology 2023Quote: ... The paired-end sequencing (150 bp × 2) was performed with Novaseq6000 (Illumina) by Chemical Dojin Co ...
-
bioRxiv - Plant Biology 2023Quote: ... and sequencing was performed using MiSeq 2 × 250 cycle paired-end (Illumina) with the Nano Kits v3 reagent ...
-
bioRxiv - Cancer Biology 2023Quote: ... depending on library complexity) or NovaSeq (SP 2×250 cycles) platform (Illumina).
-
bioRxiv - Genomics 2023Quote: ... followed by paired-end sequencing (2 × 150 bp) on a NextSeq2000 (Illumina) instrument ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were paired-end sequenced (2×75 bp) on a NextSeq500 (Illumina). BclToFastq was used for the preprocessing of the raw data (trimming and filtering) ...
-
bioRxiv - Microbiology 2023Quote: ... and sequenced (paired-end 2×75-bp) in a NextSeq500 instrument (Illumina). Alignment to the reference genome sequence of Listeria monocytogenes EGDe (RefSeq ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 or 4 nM concentration and run on NextSeq 550 sequencer (Illumina) with NextSeq 500/550 High Output v2.5 (75 cycles PE ...
-
bioRxiv - Immunology 2023Quote: ... We sequenced the libraries on 2 lanes of a NovaSeq S4 (Illumina), aligned using CellRanger (10X Genomics ...
-
bioRxiv - Cancer Biology 2023Quote: ... or paired-end (2 × 100 bp) on the Novaseq 6000 platform (Illumina).
-
bioRxiv - Genomics 2023Quote: ... the Illumina TruSeq RNA sample preparation kit v.2 (Illumina, CA, USA) was used for library preparation following the low-throughput protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Libraries were sequenced with 2×50 bp reads on a NextSeq2000 (Illumina). Demultiplexing ...
-
bioRxiv - Immunology 2021Quote: ... DRB3/4/5 kits) for sample library preparations and ran on a Miseq sequencer (Illumina), following the manufacturer’s instructions.
-
bioRxiv - Pathology 2021Quote: ... with the libraries clustered at 12-15pM and mixed with 5% PhiX genomic DNA (Illumina).
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were diluted and mixed with 5-20% phiX control v3 (Illumina FC-110-3001) and sequenced with oSK326 for read 1 and oSK324 for the index read.
-
bioRxiv - Cell Biology 2023Quote: ... and 5-day deligated samples were sequenced (the ligated sample was sequenced on the Illumina Nextseq500 and all others were sequenced on the Illumina Nextseq2000) ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Microbiology 2023Quote: ... all libraries were spiked with 5% PhiX Control v3 (Illumina, Catalog No. FC-110-3001). The NCBI Genbank accession number for the raw sequencing data reported here is PRJNA999749.
-
bioRxiv - Genomics 2023Quote: ... were dual-indexed using differing barcode indexes both for the forward (5’ P5 Illumina adapter) and reverse oligos (3’ P7 Illumina adapter) ...
-
bioRxiv - Genomics 2020Quote: ... De-multiplexing of RNA-Seq reads was conducted using bcl2fastq v.2 (Illumina). Both DNA-Seq and RNA-Seq reads were submitted to FastQC 51 for quality validation.
-
bioRxiv - Molecular Biology 2021Quote: ... 2 × 36 base paired-end sequencing was performed with a NextSeq500 sequencer (Illumina) by Tsukuba i-Laboratory LLP (Tsukuba ...
-
FOXO dictate initiation of B cell development and myeloid restriction in common lymphoid progenitorsbioRxiv - Immunology 2022Quote: ... Libraries were sequenced paired-end (2×50 cycles) on the Illumina platform (Illumina). Reads were mapped using STAR (v 2.5.2b ...
-
FOXO dictate initiation of B cell development and myeloid restriction in common lymphoid progenitorsbioRxiv - Immunology 2022Quote: ... Libraries were sequenced paired-end (2×50 cycles) on the Illumina platform (Illumina). To obtain differential ATACseq peaks ...
-
bioRxiv - Immunology 2021Quote: ... Sequencing had been performed by a 300*2 paired-end kit by Illumina MiSeq ...
-
bioRxiv - Bioengineering 2019Quote: ... and the sequencing was run with a 2×250 bp MiSeq run (Illumina).
-
bioRxiv - Cancer Biology 2019Quote: ... Libraries were sequenced (paired-end, 2 × 75 cycles) on NextSeq platform (Illumina Inc.) Fastq underwent to Quality Control using FastQC tool (https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) ...
-
bioRxiv - Genetics 2021Quote: ... and subjected to 2 × 50-bp paired-end sequencing on Hiseq XTen (Illumina).
-
bioRxiv - Neuroscience 2021Quote: ... The libraries were sequenced paired ended (2×75bp) on the NextSeq500 instrument (Illumina) to an average of at least 33 million reads ...
-
bioRxiv - Microbiology 2021Quote: ... An Illumina MiSeq Platform (2×300 cycles; Illumina Inc., San Diego, CA, USA) was used for a paired-end sequencing run ...
-
bioRxiv - Systems Biology 2020Quote: ... a 2 x 300 bp paired end library (Illumina Nextera XT DNA kit) was sequenced on a MiSeq ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μg of RNA were treated with “TruSeq RNA sample preparation kit” (Illumina) combined with a specific strand labeling using dUTPs [36] ...
-
bioRxiv - Molecular Biology 2020Quote: ... Paired-end (150 base pairs × 2) sequencing with the NovaSeq 6000 platform (Illumina) was outsourced to Takara Bio ...
-
bioRxiv - Genomics 2020Quote: ... and 2.5μL (20μM) each of 2 indexed primers (Illumina TruSeq Combinatorial Dual (CD) index adapters ...