Labshake search
Citations for Illumina :
501 - 550 of 900 citations for 3 Phenoxybenzoic Acid Phenoxy 13C6 99% 100 Ug Ml In Acetonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... The cell solutions were immediately transferred to ice and transported to the Wellcome Trust Centre for Human Genetics (WTCHG) for scRNAseq via 10x genomics chromium (10x genomics, US) (Single Cell 3’ v3) and Illumina hiseq 4000 (Illumina, US). This approach achieved 66-72K mean reads per cell and a sequencing depth of 53-55% per cell before filtering.
-
bioRxiv - Cancer Biology 2020Quote: ... TN5 tagmentation and library amplification realized 3’end fragments by Nextera XT DNA Sample Preparation Kit (Illumina, Cat#FC-131-1024) according to the manufacturer’s instructions while P5_TSO and Nextera_N7xx took the place of the custom primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... 500 ng of total RNA were used as input for QuantSeq (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina; Lexogen) following the autoQuantSeq automated workflow ...
-
bioRxiv - Microbiology 2019Quote: ... 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) were sequenced using the Illumina MiSeq 2 × 300 bp platform with MiSeq Reagent Kit v3 (Illumina Co.) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... CC (third part, forward primer linker) AGMGTTYGATYMTGGCTCAG (fourth part, forward primer) and 338R CAAGCAGAAGACGGCATACGAGAT (first part, reverse complement of 3′ Illumina adaptor) ACGAGACTGATT (second part ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were processed according to the standard 10x Chromium 3’ workflow and pooled before sequencing over two lanes (Illumina HiSeq 4000).
-
bioRxiv - Genomics 2019Quote: ... The resulting libraries always contain dual-indexes in the standard indexing positions and may optionally contain additional internal indexes (Figs. 1–3; Table 1; Illumina, 2018b). These indexes are recovered through the four standard separate sequencing reactions generated by Illumina instruments when doing paired-end sequencing (Fig ...
-
bioRxiv - Cancer Biology 2019Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina indexed adapters from TruSeq™ Stranded Total RNA Sample Preparation Kit with Ribo-Zero Gold (Illumina) were ligated.
-
bioRxiv - Cancer Biology 2020Quote: ... 500 ng alkylated RNA was used and prepared with a commercially available kit (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina and PCR Add-on Kit for Illumina, Lexogen). Sequencing was performed on an Illumina NovaSeq SP platform in 100bp-single-read mode.
-
bioRxiv - Genomics 2021Quote: ... and ligated to custom CpG-free annealed adapters (Oligo 3 - Custom CpG-free P7 adapter and Oligo 4 - Custom CpG-free P5 adapter; annealed according to the standard Illumina protocol). The adapter-ligated gDNA was purified and amplified in 20 reactions using KAPA HiFi master mix (Roche ...
-
bioRxiv - Genomics 2021Quote: ... and 1µM Dexamethasone or 0.1% ethanol for 3 hours. Transposition was performed using the OmniATAC protocol (Corces et al. 2017) and the tagment DNA TDE1 enzyme (Illumina, 20034197). DNA was purified using the MinElute PCR purification kit (Qiagen) ...
-
bioRxiv - Cell Biology 2022Quote: The input samples were submitted to the Washington University Genome Technology Access Center to obtain and sequence the cDNA libraries (10XGenomics, 3’v3.1; Illumina NovaSeq S4) according to established protocols ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl of PCR 1 were used as template for PCR 2 (14 cycles) and used forward primers 5’-AATGATACGGCGACCACCGAGATCTACAC-NNNNNNNN-ACACTCTTTCCCTACACGAC-3’ (compatible to Illumina i5) and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 x 105 mESCs and 5 x 104 S2 cells were resuspended in Tagment DNA Buffer and treated with 3 µL TDE1 Tagment DNA Enzyme (Illumina 20034197). After thorough mixing ...
-
bioRxiv - Genomics 2023Quote: For all tandem repeat identification and quantification we used DNA sequences from 2,504 individuals from the Phase 3 of the 1,000 Genomes Project (∼30x coverage Illumina short-read data) (Byrska-Bishop et al ...
-
bioRxiv - Genomics 2023Quote: ... 200ng alkylated RNA were used as input for generating 3’-end mRNA sequencing libraries using a commercially available kit (QuantSeq 3ʹ mRNA-Seq Library Prep Kit FWD for Illumina, Lexogen).
-
bioRxiv - Immunology 2024Quote: ... 2024) using the command CreateSeuratObject with the following parameters: min.cells = 3 and either min.features = 200 (for Illumina reads from MBC gate) or min.features = 100 (for the Oxford Nanopore reads from the ASC gate) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Then the scRNA-seq libraries were constructed by using the Chromium Next GEM Single Cell 3’ Reagent Kits v3 (10X Genomics, USA) and sequenced by using the sequencer Novaseq6000 (Illumina, USA). All procedures were following the manufacturer’s protocol.
-
bioRxiv - Microbiology 2020Quote: ... rRNA was removed from 100 ng of total RNA using Ribo-Zero(TM) rRNA Removal Kit (Illumina). Stranded cDNA libraries were generated using the Illumina Truseq Stranded mRNA Library Prep kit ...
-
Dual functionality of the TasA amyloid protein in Bacillus physiology and fitness on the phylloplanebioRxiv - Microbiology 2019Quote: ... and 100-bp single-end read libraries were prepared using the TruSeq Stranded Total RNA Kit (Illumina). The libraries were sequenced using a NextSeq550 instrument (Illumina) ...
-
bioRxiv - Plant Biology 2020Quote: ... A total of 24 libraries were sequenced using the HiSeq2000 configuration 100 PE (Illumina Inc. CA, USA) at the Michigan State University Genomics core laboratory.
-
bioRxiv - Cell Biology 2021Quote: ... The libraries were sequenced single read 100 bp using the Illumina Novaseq 6000 (Illumina, Inc, California, USA). Reads were quality-checked with fastqc which computes various quality metrics for the raw reads.
-
bioRxiv - Microbiology 2021Quote: ... and 100-bp single-end reads libraries were prepared using a TruSeq Stranded Total RNA Kit (Illumina). Libraries were sequenced using a NextSeq550 sequencer (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... and 100-bp single-end read libraries were prepared using a TruSeq Stranded Total RNA Kit (Illumina). The libraries were sequenced using a NextSeq550 sequencer (Illumina).
-
bioRxiv - Immunology 2022Quote: ... sample tags: 600 reads per cell on Illumina NovaSeq using S1 and S2 100 cycle kits (Illumina) (67×8×50 bp) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Approximately 100 million 75bp paired-end reads were acquired per sample on the HiSeq 2500 system (Illumina). Additional public ATAC-seq FASTQ files were downloaded from Gene Expression Omnibus (GSE80154)33 ...
-
bioRxiv - Evolutionary Biology 2022Quote: The genomic libraries were constructed using 100 ng of cpDNA and the Nextera DNA Flex kit (Illumina), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... and sequenced with a 2 × 100 bp paired-end protocol on the HiSeq 2000 Sequencing System (Illumina).
-
bioRxiv - Neuroscience 2019Quote: ... Paired-end 100 bp sequencing reads were obtained using Illumina Hi-seq 2500 (Illumina, San Diego, CA).
-
bioRxiv - Cell Biology 2019Quote: ... Libraries were sequenced using paired eind sequencing length of a 100 nucleotides on a HiSeq4000 machine (Illumina).
-
bioRxiv - Microbiology 2021Quote: ... The sequencing was performed with NovaSeq 6000 SP Reagent Kit (100 cycles) on NovaSeq 6000 System (Illumina).
-
bioRxiv - Cancer Biology 2021Quote: ... Beta-values were calculated from the retransformed intensities using an offset of 100 (as recommended by Illumina). All samples were checked for duplicates by pairwise correlation of the genotyping probes on the 450k/EPIC array ...
-
bioRxiv - Immunology 2020Quote: ... and sequenced with a 2×100 bp paired-end protocol on the HiSeq 4000 Sequencing System (Illumina).
-
bioRxiv - Immunology 2020Quote: ... and 100 ng RNA was processed for directional library preparation (Truseq stranded total RNA library kit, Illumina). Libraries were pooled and sequenced paired-ended for 2×75 cycles on a Nextseq500 sequencer (Illumina ...
-
bioRxiv - Cancer Biology 2020Quote: ... Beta-values were calculated from the retransformed intensities using an offset of 100 (as recommended by Illumina). All samples were checked for duplicates by pairwise correlation of the genotyping probes on the 450k/850k array ...
-
bioRxiv - Cancer Biology 2022Quote: ... Paired end sequencing (2 x 100 bp) of these libraries were performed in the HiSeq 2500 (Illumina). Quality control analysis of the raw data using the NGS QC ToolKit was done ...
-
bioRxiv - Cancer Biology 2022Quote: ... pooled and sequenced as 100 bp paired-end runs on a HiSeq2000 system (Illumina, San Diego, CA), as previously described 47 ...
-
bioRxiv - Genetics 2022Quote: ... The library was paired-end sequenced (2×100 bp) on HiSeq 1500 (Illumina, San Diego, CA, USA) to the mean depth > 100x (the min ...
-
bioRxiv - Molecular Biology 2022Quote: Equimolar amounts of libraries for Enzymatic Methyl-seq were first sequenced on the iSeq 100 instrument (Illumina) using paired-end sequencing of 2x151 to assess both library and pooling qualities ...
-
bioRxiv - Immunology 2022Quote: ... and sequenced with a 2×100 bp paired-end protocol on the HiSeq 4000 Sequencing System (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... A NovaSeq S1 v 1.5 or SP v 1.5 Reagent Kit (100 cycles) (Illumina, 20028319 and 20028401) was used ...
-
bioRxiv - Cell Biology 2023Quote: ... beta values were calculated from the retransformed intensities using an offset of 100 (as recommended by Illumina). Out of 865,859 probes on the EPIC array ...
-
bioRxiv - Cancer Biology 2023Quote: ... in single-end mode using the NextSeq 2000 P2 Reagents (100 Cycles) kit (Illumina, cat. no. 20040559). For scCUTseq experiments on TK6 cells ...
-
bioRxiv - Developmental Biology 2024Quote: ... The final pools were sequenced on NovaSeq 6000 platform using SP Reagent Kit v1.5/ 100 cycles (Illumina) with 28×8×91 configuration run leading to 40000 reads/cell.
-
bioRxiv - Evolutionary Biology 2024Quote: ... Paired-end 100-base sequencing was conducted on the NextSeq 2000 P3 sequencing platform (Illumina, CA, USA). Reads were trimmed using trimmomatic v0.39 (83 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... we combined 3 μl of each sample (approx 2.24 ng) with a small quantity of a Nextera™ tagment DNA enzyme (Illumina catalogue #15027865). To decrease costs ...
-
bioRxiv - Microbiology 2021Quote: ... The libraries were sequenced using an Illumina MiSeq with MiSeq Reagent Kit v.3 (2x 300 bp, Illumina, San Diego, CA, USA) according to manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... The quantitative 3-step real-time PCR was performed by the Eco Real-Time PCR system (Illumina Inc., San Diego CA, USA) and CFX Connect (Bio-Rad Laboratories AG ...
-
bioRxiv - Genetics 2019Quote: ... with the European individuals from the 1000G phase 3 reference panel and from the Human Genome Diversity Panel data30 (HGDP, Illumina HuHap 650k), to generate four genome-wide SNP datasets analyzed independently.
-
bioRxiv - Immunology 2019Quote: Single-cell RNA-sequencing libraries were generated using the 10x Genomics Single Cell 3’ Solution (version 2) kit and sequenced to an average depth of > 200k reads/cell (Illumina HiSeq 4000). Data analysis was performed using Python3 pipelines (https://github.com/sansomlab/tenx ...