Labshake search
Citations for Illumina :
5201 - 5250 of 8781 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Then strand-specific libraries were prepared using the TruSeq® Stranded Total RNA Sample Preparation kit (Illumina, USA). TruSeq PE (paired-end ...
-
bioRxiv - Microbiology 2020Quote: ... library preparation was carried out using an adapted tagmentation and Nextera kit from Illumina (Baym et al. 2015). Raw reads were deposited to NCBI SRA under BioProject PRJNA646688.
-
bioRxiv - Microbiology 2021Quote: ... then 1 μg of RNA was used for library preparation with TruSeq Stranded mRNA Library Preparation Kit (Illumina) per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The ribosomal RNA from eukaryotes and bacteria were removed using the Ribo-Zero Plus rRNA Depletion Kit (Illumina), and RNAseq libraries were constructed with either the NEB directional RNA preparation kit (P ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were then prepared following the instructions of the TruSeq DNA Sample Preparation Kit (Illumina, #FC-121-2001) and sequenced on the HiSeq 2000 ...
-
bioRxiv - Plant Biology 2020Quote: ... custom adapters for selecting 5’-P mRNAs and primers from the TruSeq Small RNA Sample Preparation Kit (Illumina) for multiplexing the libraries as indicated in Zhai et al (2014) ...
-
bioRxiv - Plant Biology 2020Quote: ... and ∼25 ng of sRNA was used for library construction with the TruSeq Small RNA Prep Kit (Illumina) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: Isolates were prepared for sequencing using the TrueSeq Nano DNA HT Library Preparation kit (Illumina, San Diego, USA). The libraries were sent to the Functional Genomics Centre Zurich (ETH Zurich and University of Zurich ...
-
bioRxiv - Physiology 2020Quote: Sequencing libraries (n=167) were prepared with the TruSeq Stranded mRNA HS kit (Illumina, San Diego, California, USA). The 2100 Bioanalyzer using the DNA 1000 kit (Agilent Technologies ...
-
bioRxiv - Systems Biology 2020Quote: ... fragmented to 260 bases and libraries were built using the TruSeq stranded mRNA kit (Illumina®, California, U.S.A.) with an Applied BioSystem 2720 Thermal Cycler and barcoded adaptors ...
-
bioRxiv - Genomics 2021Quote: ... libraries were sequenced on an Illumina NextSeq 500 instrument using the 75-cycle High Output v2 Kit (Illumina). We loaded the library at 2.0 pM and provided Custom Read1 Primer (GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC ...
-
bioRxiv - Immunology 2021Quote: ... All SMART-Seq2 Libraries were sequenced using a NextSeq 500/550 High Output v2 kit 75 cycles (Illumina) on a Nextseq 500 (Illumina).
-
bioRxiv - Immunology 2020Quote: ... Samples were barcoded and used for 50bp/50bp paired end runs with the TruSeq SBS Kit v4 (Illumina) on a HiSeq 2500 sequencer ...
-
bioRxiv - Microbiology 2020Quote: ... A paired-end library was prepared using Nextera XT DNA library preparation kit (Illumina, San Diego, CA, USA). All the libraries were multiplexed on one MiSeq run ...
-
bioRxiv - Genomics 2021Quote: ... Transcriptome libraries were prepared with a TruSeq RNA library Prep kit v2 (Cat. No. RS-122-2001, Illumina) according to the manufacturer’s protocol and sequenced at the CCHMC Core Facility using Illumina HiSeq 2500 sequencing system (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... Beads were then re-suspended in the tagmentation mix (19 μl tagmentation buffer + 1μl Tagment DNA enzyme supplemented with 5μl nuclease-free water) from the Nextera DNA Sample Prep kit (Illumina) and incubated at 37°C for 10 minutes in a thermocycler ...
-
bioRxiv - Genetics 2021Quote: ... DNA libraries for whole genome sequencing were prepared with Nextera DNA Library Prep Kit (FC-121-1031, Illumina). Libraries for RADseq were prepared according to the procedures of Adapterama III74 with few modifications ...
-
bioRxiv - Genetics 2021Quote: Libraries of extracted mRNA were prepared with RNA HyperPrep kit (KAPA) and sequenced on a HiSeq 3000 (Illumina). RNA-seq reads were mapped to the leopard gecko draft genome15 using HISAT2 with default parameters ...
-
bioRxiv - Genetics 2020Quote: ... Libraries were prepared with the Accel-NGS Methyl-Seq DNA Library Kit from Illumina (Cat No. 30096, Swift) and the sequencing was performed at Novogene (Hongkong ...
-
bioRxiv - Genetics 2020Quote: ... ribosome profiling was performed using the TruSeq Ribo Profile (Mammalian) Library Prep Kit (Illumina, San Diego, CA; USA), according to a TruSeq Ribo Profile protocol optimized for use on tissue material ...
-
bioRxiv - Genetics 2020Quote: ... a slightly modified procedure was used due to the termination of the TruSeq RiboProfile kit production by Illumina. The isolation of ribosome footprints is identical to the procedure with the TruSeq kit and as described in (Heesch et al. ...
-
bioRxiv - Genetics 2021Quote: ... Libraries for genome sequencing were constructed with dual indexing using 0.5-2.5 ng per reaction using a Nextera XT kit (Illumina). The libraries were multiplexed and sequenced on an Illumina HiSeq 2500 v4 or NextSeq sequencer using paired end 125 bp output ...
-
bioRxiv - Cell Biology 2020Quote: QC and quantification of libraries were done by Bioanalyzer (High-Sensitivity DNA Bioanalyzer kit) and mi-seq (Illumina). Sequencing was carried out at the New York Genome Center (NYGC ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl Tagment DNA Enzyme and 20 μl nuclease free water (Nextera DNA Sample Preparation Kit, Illumina, UK) for 45 min at 37°C ...
-
bioRxiv - Genomics 2021Quote: Pooled PCR products were subjected to multiplex next-generation sequencing (NGS) using the MiSeq Reagent Kit v2 (Illumina) or the NextSeq 500/550 v2 Reagent Kit (Illumina) ...
-
bioRxiv - Genomics 2021Quote: ... DNA libraries were prepared with the insert size of 150 bp paired-end using NexteraXT DNA kit (Illumina) and sequenced on the Nextseq (Illumina ...
-
bioRxiv - Physiology 2021Quote: ... Total RNA libraries were prepared into an indexed library using TruSeq Stranded total RNA library prep kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: Analysis of pluripotency gene expression profile was performed using the Human-HT-12-v4 expression BeadChip Kit (Illumina) and subsequent Pluritest analysis ...
-
bioRxiv - Microbiology 2021Quote: ... The purified DNA was used for Illumina sequencing library construction using a KAPA Hyper Prep Kit (for Illumina) (KAPA Biosystems ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA libraries were generated from 200 ng total RNA using a TruSeq stranded mRNA library preparation kit (Illumina). The resultant libraries were sequenced on NextSeq550 (Illumina ...
-
bioRxiv - Cell Biology 2020Quote: ... 1.5 μg of total RNA was used to construct sequencing libraries by TruSeq RNA Sample Preparation Kit (Illumina) according to the manufacturer’s instructions
-
bioRxiv - Microbiology 2021Quote: ... libraries were prepared using Tru-Seq Stranded mRNA Library Prep kit for NeoPrep (Illumina, San Diego, CA, USA) using 100ng total RNA input according to manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Genomic DNA libraries were prepared for Illumina sequencing using Nextera XT Library Prep Kit (Illumina, San Diego, USA) according to the manufacturer’s protocol with the following modifications ...
-
bioRxiv - Biochemistry 2021Quote: ... PCR products were gel purified in 3% agarose gel and qPCRed (using NEBNext Library Quant Kit for Illumina) to quantify concentration ...
-
bioRxiv - Biochemistry 2021Quote: ... 150 ng of sheared fragments was used as input for the TruSeq Nano DNA Library Prep Kit (Illumina). Illumina libraries were prepared following the manufacturer’s protocol with one modification to yield a narrow fragment distribution optimized for 150 bp inserts by using a ratio of 5.4 parts of sample purification beads to one part of water (135 μl SPB + 25 μl nuclease-free H2O ...
-
bioRxiv - Immunology 2021Quote: ... Poly(A)+-enriched cDNA libraries were generated using the Illumina TruSeq RNA Library Prep kit v2 (Illumina Inc). The 75 bp single-end reads were sequenced was performed using an Illumina (Illumina Inc ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA-seq libraries were prepared using the Tru Seq RNA Sample Preparation kit (Illumina, San Diego, CA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... and Illumina libraries were prepared with different indexes using Nextera XT Library Prep Kit (Illumina, FC-131-1096). Prior to sequencing ...
-
bioRxiv - Neuroscience 2021Quote: ... 200pg of cDNA were used for library preparation using the Nextera XT kit (Illumina, San Diego, CA, USA). Library molarity and quality was assessed with the Qubit and Tapestation using a DNA High sensitivity chip (Agilent Technologies ...
-
bioRxiv - Genetics 2021Quote: ... cDNA libraries were built using the TruSeq stranded mRNA library preparation kit (Illumina Inc.; San Diego CA, USA). RNA sequencing (50 bp paired-end reads ...
-
bioRxiv - Genomics 2021Quote: ... a genomic library was constructed using a TruseqNano DNA HT sample preparation Kit (Illumina, San Diego, California, USA), purified using an AMPure XP bead system (Beckman Coulter ...
-
bioRxiv - Physiology 2021Quote: ... and sequenced in three batches using the NovaSeq 6000 S2 system and reagent kits (100 cycles) (Illumina, Inc) at the BioMicro Center Core at MIT.
-
bioRxiv - Physiology 2021Quote: Sequencing libraries were prepared using the Illumina Nextera XT DNA Sample Preparation kit (Illumina, Ref. FC-131-1096) and the combination of 384 Unique Dual Indexes (Illumina-Set A to D ...
-
bioRxiv - Cancer Biology 2020Quote: ... in paired-end mode on Illumina (2×101 bp) using TrueSeq DNA exome kit (v.6) (Illumina Inc.). Paired-end reads were aligned to the human reference genome sequence GRCh38 using BWA–MEM (V0.715-r1140 ...
-
A tale of two transcriptomic responses in agricultural pests via host defenses and viral replicationbioRxiv - Genomics 2020Quote: ... Ribosomal RNA (rRNA) depletion was performed on the RNA samples using the RiboZero kit (Illumina, San Diego, CA) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Each sample was then made compatible for deep sequencing using the Nextera TruSeq sample preparation kit (Illumina, USA). Specifically ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were diluted to 0.2 ng/μl and tagmented with the Nextera XT DNA Library Preparation Kit (Illumina). Samples were sequenced as previously described (18) ...
-
bioRxiv - Cell Biology 2021Quote: ... libraries from control or Atx2 RNAi 3rd instar larvae brains were prepared using TruSeq stranded mRNA kit (Illumina). 3 control and 3 Atx2 RNAi libraries were prepared ...
-
bioRxiv - Genetics 2021Quote: ... Multiplexed NGS libraries were prepared using the TruSeq PCR Free kit according to the manufacturer’s instructions (20015963, Illumina). The obtained libraries were sequenced using a Miseq 600 cycle kit to generate 150 bp and 300 bp paired-end reads to a depth of approximately 5-20X coverage ...
-
bioRxiv - Genomics 2021Quote: ... Paired-end (PE) DNA libraries were constructed using the Nextera XT DNA kit (Illumina, San Diego, CA, USA) according to the manufacturer’s protocol ...