Labshake search
Citations for Illumina :
5151 - 5200 of 10000+ citations for HDM Fluorescent Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Purified DNA was used for library preparation using the NEBNext Ultra Library prep Kit (Illumina) according to manufacturer’s instructions with the following Epicypher manufacturer’s modifications ...
-
bioRxiv - Microbiology 2023Quote: ... one nanogram of DNA was fragmented and adapter ligated using the Nextera XT kit (Illumina) and unique 8bp dual-index adapters (IDT ...
-
bioRxiv - Immunology 2023Quote: ... Libraries were prepared using an Illumina Stranded mRNA Library Prep kit (Illumina, Cat no. 20040534) with IDT for Illumina RNA Unique Dual Index adapters following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2023Quote: ... and sequenced on an Illumina MiSeq using the MiSeq Reagent kit v3 (Illumina, 600 cycles). Individual amplicon pools were extracted from the raw sequencing data using the FASTQ workflow in BaseSpace (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA-seq libraries were prepared using the Illumina TruSeq Stranded mRNA Library Prep Kit (Illumina) according to manufacturer instructions and sequenced on a HiSeq 2500 platform (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... and converted to cDNA (NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina). cDNA from each sample was amplified and barcoded in a mild stringency PCR (20 cycles of 30 seconds at 98°C ...
-
bioRxiv - Immunology 2023Quote: ... an Illumina library was prepared using a Nextera DNA Library Preparation Kit (Illumina, SanDiego, CA) according to SMARTer kit instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Next-generation sequencing libraries were prepared with a Nextera XT kit (Illumina, San Diego, CA), and libraries were sequenced on an Illumina MiSeq using 300-bp paired-end reads ...
-
Engineering TALE-linked deaminases to facilitate precision adenine base editing in mitochondrial DNAbioRxiv - Molecular Biology 2023Quote: ... RNA libraries were prepared using a TruSeq Stranded Total RNA Library Prep Gold kit (Illumina). RNA library quality was assessed using a 2200 TapeStation with a D1000 ScreenTape system (Agilent) ...
-
bioRxiv - Systems Biology 2023Quote: ... Strand-specific sequencing libraries were constructed using the TruSeq Stranded Total RNA Prep kit (Illumina). DNA sequencings were performed at the NHLBI DNA Sequencing and Genomics Core ...
-
bioRxiv - Plant Biology 2023Quote: ... Libraries were constructed by Macrogen using the TruSeq Stranded mRNA LT Sample Prep Kit (Illumina). Libraries were sequenced on an Illumina NovaSeq6000 platform NovaSeq6000 via paired-end sequencing of 150bp reads ...
-
bioRxiv - Bioengineering 2023Quote: ... Nextera XT Index Kits (96 indexes, 384 samples) were purchased from Illumina (FC-131-1002). Axygen AxyPrep Mag PCR Clean-up Kits were purchased from Thermo Fisher Scientific (MAGPCRCL) ...
-
bioRxiv - Genetics 2023Quote: ... DNA was extracted from whole blood using MasterPure DNA Purification Kit (Biozym, Illumina Inc, USA). DNA quality and quantity estimation was done by agarose gel electrophoresis and spectrophotometry ...
-
bioRxiv - Cell Biology 2022Quote: ... Nuclei pellets resuspended in 50μl of Nextera DNA Sample Preparation Kit (Illumina FC-121-1030) for tagmentation ...
-
bioRxiv - Molecular Biology 2023Quote: We used the TruSeq small RNA library prep sequencing kit (Illumina, San Diego, CA, USA) for library preparation according to manufacturing instructions except for the changes listed below ...
-
bioRxiv - Cancer Biology 2023Quote: RNA-Seq libraries for Illumina sequencing were prepared using TruSeq stranded mRNA kit (Illumina, 20020595) according to manufacturer’s instructions for high-throughput sample workflow ...
-
bioRxiv - Cancer Biology 2023Quote: ... sequencing was performed using the HiSeq 3000/4000 SBS Kit (50 cycles, Illumina, SanDiego, USA) on an Illumina HiSeq 3000/4000 (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA-seq libraries were prepared with the TruSeq stranded total RNA library prep kit (Illumina). single-end sequencing (75 bp ...
-
bioRxiv - Genomics 2023Quote: Sequencing libraries were prepared using the Nextera FLEX kit and Nextera Unique Dual Indexes (Illumina). Pooled libraries were sequenced on a NovaSeq 6000 (Illumina).
-
bioRxiv - Genetics 2023Quote: ... Libraries were prepared using Nextera XT DNA library preparation kits (Illumina, Inc., San Diego, CA) following the manufacturers protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... and sequenced (100 bp paired-end reads) using a TruSeq 200 cycle SBS kit (Illumina). Samples were run on an Illumina HiSeq2000 sequencer (tissue specimens ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA libraries were prepared with Illumina TruSeq RNA sample preparation kits (RS-122-2002, Illumina). RNA integrity was assessed using an Agilent 2100 Bioanalyzer (cutoff value of RIN 8 or higher ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were constructed following the manufacturer’s protocol (NEBNext UltraTMII DNA Library Prep Kit for Illumina). For each sample ...
-
bioRxiv - Microbiology 2022Quote: ... Libraries were sequenced on the MiSeq Reagent Kit v2 (300 cycles) (Illumina MS-102-2002) using the following read structure ...
-
bioRxiv - Genomics 2023Quote: ... Ribosomal RNA was removed with the RiboZero-Gold rRNA removal Kit (Illumina, cat. No MRZG12324). Ribosome protected fragments were size selected from a 15% denaturing urea polyacrylamide gel (PAGE ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing was performed using the Miniseq® High Output Kit (Illumina®, San Diego, USA) generating paired-end reads of 150 bp ...
-
bioRxiv - Genomics 2023Quote: ... and used for standard poly(A)+ selection and library preparation with the TruSeq kit (Illumina). Following sequencing to at least 20 million reads on a NovaSeq platform (Illumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and strand-specific polyA-selected libraries were generated with TruSeq RNA Library Preparation Kit (Illumina). The obtained libraries were combined in an equimolar amount and loaded on Illumina flow cell lanes ...
-
bioRxiv - Cancer Biology 2023Quote: ... Recommended protocol for Infinium MethylationEPIC Kit was used (Infinium HD Methylation Assay Reference Guide, Illumina). Laboratory procedures were performed by Eurofins Genomics service.
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were sequenced on an NextSeq 550 platform (Illumina, 75 cycles High Output Kit v2.0) and 75-bp paired-end reads were generated ...
-
bioRxiv - Microbiology 2023Quote: ... libraries were generated using the Illumina TruSeq DNA PCR-Free Library Preparation Kit (Illumina, USA), and index codes were added ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... DNA was tagmented using Nextera XT DNA library preparation kit (FC-131-1096, Illumina, USA) and dual-indexed with Nextera XT Index Kit V2 Sets A-D (FC-131-2001 ...
-
bioRxiv - Genetics 2023Quote: ATAC-seq was performed using the Nextera DNA Library Prep Kit (Illumina FC-121-1030). Briefly ...
-
bioRxiv - Microbiology 2023Quote: ... and sequencing libraries were constructed with NEBNext UltraII Directional RNA Library Preparation Kit (Illumina, #E7760) as described previously [65] ...
-
bioRxiv - Microbiology 2023Quote: ... A DNA library was prepared with the Nextera XT DNA Sample Prep Kit (Illumina, USA), followed by sequencing with the Illumina MiSeq Reagent Kit v2 ...
-
bioRxiv - Cell Biology 2023Quote: ... and RNA-seq was performed using the Miseq Reagent Kit V2 (MS-102-2001, Illumina).
-
bioRxiv - Developmental Biology 2023Quote: ... and cDNA libraries were generated using the Illumina TruSeq Stranded mRNA Sample Prep Kit (Illumina). Samples were sequenced on the Illumina HiSeq2500 platform as 150-bp single-end reads ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing was conducted on a NovaSeq 6000 with a 300 cycle Reagent kit v1.5 (Illumina) to produce 150 bp paired-end ...
-
bioRxiv - Biochemistry 2023Quote: ... RNA-sequencing libraries were prepared using the NEBNext Ultra II RNA Library Prep Kit (Illumina). Paired-end 150bp sequencing was done on a NovaSeq 6000 machine (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... The RNA libraries were created using the TrueSeq Small RNA Library preparation kit from Illumina, and then sequenced for 45 cycles on the Illumina HiSeq 2000 platform (1 x 75bp read length) ...
-
bioRxiv - Neuroscience 2023Quote: The RNA Seq library was generated using Illumina Tru-Seq stranded mRNA kit (Illumina 20020594) as per manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: RNA was used to prepare cDNA libraries with a Truseq sRNA library prep kit (Illumina), following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were sequenced on a NextSeq 500/550 Mid Output v2.5 kit (300 cycle) (Illumina) using 150 bp paired-end reads ...
-
bioRxiv - Molecular Biology 2023Quote: ... The removal of rRNA was performed utilizing the Ribo-Zero Gold rRNA Removal Kit (Illumina). The linker-conjugated RNAs were reverse-transcribed ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA-seq transcriptome libraries were prepared using the TruSeq RNA sample preparation kit from Illumina, and sequencing was performed on an Illumina Novaseq 6000 by Novogene.
-
bioRxiv - Neuroscience 2023Quote: ... RNA-Seq libraries were subsequently prepared with the TruSeq Stranded mRNA Sample Prep Kit (Illumina) and subjected to 125 bp paired-end sequencing using a HiSeq2500 (Illumina) ...
-
bioRxiv - Genomics 2023Quote: ... Final libraries were run on three NextSeq500 High-output v2.5 150-cycle kits (Illumina, CA) with a 26[8]98 cycle configuration to generate 50,000 reads per cell (10X Genomics recommendation).
-
bioRxiv - Microbiology 2023Quote: ... DNA libraries were prepared using the Illumina DNA Prep kit (Illumina, San Diego, CA, USA) and IDT for Illumina DNA/RNA UD Indexes sets (Ilumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... ∼1 µg of RNA was used to construct libraries with Truseq Stranded mRNA kit (Illumina) and barcoded with IDT for Illumina-TruSeq DNA and RNA UD Indexes ...