Labshake search
Citations for Illumina :
451 - 500 of 1364 citations for SUN domain containing protein 2 SUN2 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2022Quote: ... and sequenced with 2 × 250 base paired-end reads on the Illumina MiSeq platform (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... Each library was then paired end sequenced (2×75bp) on a NextSeq 500 instrument (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... Sample libraries of sufficient quality were sequenced (Illumina MiSeq; paired end 2 × 75bp read length) with a sequencing depth targeted at 7-10M total paired end reads/sample at the Center for Genome Innovation at the University of Connecticut.
-
bioRxiv - Genomics 2020Quote: ... and then subjected to Next Generation Sequencing in NextSeq 550 equipment (2×150bp) (Illumina, USA). The reads were deposited in the European Nucleotide Archive (ENA ...
-
bioRxiv - Systems Biology 2020Quote: ... Paired-end sequencing (2×125-bp) was carried out on a HiSeq 2500 instrument (Illumina) at the Kinghorn Center for Clinical Genomics ...
-
bioRxiv - Microbiology 2020Quote: ... DNA sequencing was performed using a MiSeq v2 500 cycle kit (2×250bp reads; Illumina). Raw reads were trimmed using fastq-mcf and assembled using SPADES v3.9.1 [25] ...
-
bioRxiv - Microbiology 2021Quote: ... High-throughput sequencing was performed with a MiSeq Illumina sequencer (2 × 300 bp, Illumina Inc.) by the Biomics Pole (Institut Pasteur) ...
-
bioRxiv - Immunology 2021Quote: The 150×2 paired-end sequencing was conducted on a Novaseq sequencer (Illumina, CA, USA) producing 612,180,910 raw paired reads on average.
-
bioRxiv - Cancer Biology 2020Quote: ... 1–2 mg of total RNA was used for Ribo-Zero rRNA Removal kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were sequenced as paired end 2×151 read multiplex runs on MiSeq platform (Illumina). Sequenced reads have been uploaded to the NCBI SRA database under BioProject ID PRJNA762079.
-
bioRxiv - Genomics 2021Quote: ... the 18 individual libraries were pooled using equimolar amounts and sequenced by Illumina NovaSeq 2×150 cycles run for a total of 0.5 lane (Illumina Inc., CA, U.S.)
-
bioRxiv - Microbiology 2021Quote: ... Sequencing libraries were constructed from 2 μL of DNA using the Nextera XT Kit (Illumina) and cleaned with 0.6x volumes of Ampure XP beads (Beckman Coulter) ...
-
bioRxiv - Physiology 2022Quote: ... Samples were sequenced on the HiSeq 2500 (Figure 2) or NovaSeq 6000 (Figure 6; Illumina) using a 2×100 kit to a read depth >45 million reads/sample ...
-
bioRxiv - Genomics 2022Quote: ... We downsampled the existing Illumina (2×150 bp, generated with Illumina HiSeq 2500 Rapid SBS) alignment file of 300× to ~100× ...
-
bioRxiv - Cancer Biology 2022Quote: Paired-end sequencing (2 x 150 bp) was performed with HiSeq X-Ten instruments (Illumina). Two lanes ...
-
bioRxiv - Microbiology 2022Quote: ... Whole genome was paired-end sequenced (2 × 150 bp) in an Illumina NovaSeq6000 platform (Illumina) at Centro Nacional de Análisis Genómico (CNAG-CRG ...
-
bioRxiv - Plant Biology 2023Quote: ... before being prepared for loading using a NovaSeq XP 2 lane kit v1.5 (20043130, Illumina). This was sequenced with 150 paired-end reads on an Illumina NovaSeq 6000 with NVCS 1.7.5 and RTA v3.4.4 on one lane of a NovaSeq S4 v1.5 flow cell with accompanying reagent cartridges (20028312 ...
-
bioRxiv - Neuroscience 2024Quote: ... using using 2 NextSeq 500 High Output Kit 75-cycles (Illumina, Cat# FC-404-1005) loaded at 2.5pM and including 1% PhiX ...
-
bioRxiv - Microbiology 2024Quote: ... The sequencing was performed using the Illumina MiSeq (2 × 300 bp) platform (Illumina Inc., USA) at Macrogen Inc ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing was performed in 2 x 250 bp paired-end format (Illumina, San Diego, CA). A total of 168 samples were sequenced on two separate sequencing runs at a similar read depth ...
-
bioRxiv - Molecular Biology 2024Quote: ... utilizing a paired-end 150 bp (2×150 bp) configuration (Illumina Inc., San Diego, CA). The sequencing service was provided by Novogene Co. ...
-
bioRxiv - Immunology 2023Quote: ... and sequenced using the MiSeq 2 × 300 base pair (bp) paired-end sequencing platform (Illumina). Integrated indexed flow cytometry and sequence data integration as well as Ig gene annotation was performed using sciReptor version 1.0-6-g034c8ae (Busse et al. ...
-
bioRxiv - Microbiology 2023Quote: ... 2.5 μl of Nextera XT index primers 1 and 2 (Nextera XT Index kit, Illumina) and 2.5 μl of templated DNA ...
-
bioRxiv - Molecular Biology 2022Quote: The whole genome sequencing of SARS-CoV-2 was performed on MiSeq System (Illumina technology), that is installed at R’VRDL ...
-
bioRxiv - Microbiology 2022Quote: ... and then sequenced at 2×250bp on an Illumina MiSeq (Illumina, San Diego, CA, USA) at the Genomics Core Facility ...
-
bioRxiv - Biophysics 2023Quote: ... using iSeq 100 i1 reagent v2 kit (300 cycle) 2 x 150 read length (Illumina). The total number of reads were 150,000-400,000 per sample ...
-
bioRxiv - Cancer Biology 2023Quote: DNA isolated from the immunoprecipitated samples underwent paired-end sequencing (2×150bp on an Illumina NovaSeq-S4-PE 150 Cycle instrument ...
-
bioRxiv - Microbiology 2023Quote: ... paired read approach to sequence amplicons using the MiSeq 2 × 250 platform (Illumina, Inc. USA) at the Georgia Genomics and Bioinformatic Core (UGA ...
-
bioRxiv - Molecular Biology 2023Quote: ... Paired-end sequencing (2 x 50 nt) was performed on a NovaSeq 6000 system (Illumina).
-
bioRxiv - Neuroscience 2023Quote: ... The pellet was resuspended in 50 μl of transposition mixture (25 μl of 2× Illumina Tagment DNA buffer ...
-
bioRxiv - Microbiology 2023Quote: ... converted into cDNA and sequenced using an Illumina Hiseq®2500 v.2 (Illumina, Singapore), 150 bp paired- end ...
-
bioRxiv - Microbiology 2023Quote: ... using a 600 (2×300 base pair) cycle reagent kit (Illumina Inc, San Diego, CA).
-
bioRxiv - Genomics 2023Quote: ... and paired-end (2 × 150 bp) sequenced on an Illumina NovaSeq 6000 system (Illumina, USA). For full-length transcript sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA fragments were then amplified by PCR using Nextera index primer 1 and 2 (Illumina) and produced by PCR amplification (10–13 cycles ...
-
bioRxiv - Cancer Biology 2024Quote: ... and sequenced with a NovaSeq sequencing system using the 2 x 150 bp protocol (Illumina) for approximately 25-30 million reads per sample.
-
bioRxiv - Microbiology 2024Quote: Genomic DNA from each W2 sample was sequenced (Illumina MiSeq 150×2 bp, GENOSCREEN, France) yielding 15.8 ±8 million paired-ends reads per sample ...
-
bioRxiv - Microbiology 2024Quote: ... the SARS-CoV-2 whole genome was recovered using Illumina COVIDSeq Test (Illumina, CA, USA) and the ARTIC 4.1v primer set (https://artic.network/) ...
-
bioRxiv - Microbiology 2024Quote: ... The 16S amplicons were sequenced on an Illumina MiSeq sequencer (2 × 300 bp) (Illumina, USA).
-
bioRxiv - Cell Biology 2024Quote: ... Libraries were normalized and pooled at 2 nM and spike-in PhiX Control v3 (Illumina) was added ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we sequenced paired-end reads with a 2×151+18+8bp length on NovaSeq6000 (Illumina) to reach at ~30X coverage per sample ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were sequenced using paired end sequencing (2 x 150bp) on a NovaSeq platform (Illumina). 2-5 million read pairs were sequenced for each replicate ...
-
bioRxiv - Molecular Biology 2024Quote: Libraries were sequenced using paired end sequencing (2 x 150bp) on a NovaSeq platform (Illumina). Read depth varied depending on experiments ...
-
bioRxiv - Cell Biology 2024Quote: ... Sequencing is carried out as 2 × 150 bp paired-end on a NovaSeq 6000 (Illumina). Sequencing reads were mapped to the human genome (GRCh38 ...
-
bioRxiv - Genomics 2020Quote: ... Genomic DNA libraries containing 300∼500 bp fragments were constructed using Nextera XT DNA Library Preparation Kit (Illumina Inc., San Diego, USA). The WGS was performed using 100 bp paired-end sequencing protocol under Illumina platform using HiSeq4000 sequencer (Macrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... an equal combination of additional PCR products containing two inverse barcodes (GACTCAGTGTCAGACTGAGTGTCTGACTGT and CTGAGTCACAGTCTGACTCACAGACTGACA) plus the PhiX Control V3 (Cat. FC-110-3001, Illumina, CA, USA) were spiked in to balance the nucleotide distribution within the library ...
-
bioRxiv - Genetics 2020Quote: ... 0.02 µM of specific adapters for the Illumina technology (containing the barcode sequences and complementary to the Illumina ™ primers for sequencing) were connected to the fragments ends generated in the digestion ...
-
bioRxiv - Microbiology 2021Quote: Bacterial 16S V3-V4 regions were amplified by PCR using universal primers derived from DBact-0341-b-S-17 and S-D-Bact-0785-a-A-21 (24) containing unique adapters for the Nextera XT indexing kit according to the manufacturer’s instructions (Illumina Inc., San Diego, CA). Fungal ITS2 regions were amplified using separate unique adapter primers derived from IST3_KYO1 and IST4_KYO1 (25) ...
-
bioRxiv - Immunology 2020Quote: ... PCR amplification and index incorporation were performed in a 50 μl reaction containing 5 μl of forward and reverse index primers (Illumina Nextera Index Kit), 15 μl NPM ...
-
bioRxiv - Genomics 2023Quote: ... The pelleted nuclei were gently resuspended with 50 µl of transposition reaction containing 25 µL 2X Tagmentation buffer (Illumina Cat FC-121-1030), 5 µL Tn5 transposase (Illumina Cat FC-121-1030 ...
-
bioRxiv - Genomics 2023Quote: ... 4 μl of 1 ng amplicon DNA was combined with a mix containing 1 μl of Amplicon Tagment Mix (Illumina, FC- 131-1096) and 5 μl of Tagment DNA Buffer (Illumina ...