Labshake search
Citations for Illumina :
451 - 500 of 8868 citations for Rat Hypoxia inducible factor 3 alpha HIF3A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... TruSeq Stranded mRNA kit (Illumina 20020594) was used for library preparation from total RNA according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... with High Output NextSeq kit (Illumina) using 2x 75bp paired-end reads.
-
bioRxiv - Cancer Biology 2023Quote: ... the Truseq Stranded mRNA kit (Illumina) was used with an input of 100 nanograms of total RNA ...
-
bioRxiv - Immunology 2023Quote: ... the Truseq Stranded mRNA kit (Illumina) was used with an input of 100 nanograms of total RNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... the Truseq Stranded mRNA kit (Illumina) was used with an input of 100 nanograms of total RNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... the Truseq Stranded mRNA kit (Illumina) was used with an input of 100 nanograms of total RNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... using HiSeq SBS Kit v4 (Illumina) (Fasteris ...
-
bioRxiv - Cancer Biology 2023Quote: ... 200-cycle sequencing kit (Illumina Inc.) to a depth of 70M reads per sample.
-
bioRxiv - Plant Biology 2024Quote: ... using Nextera Library Prep Kits (Illumina), following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... Using TruSeq stranded mRNA kit (Illumina), the fragmented mRNA was reverse transcribed to create the first strand of cDNA with random hexamers and SuperScript™ II Reverse Transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2024Quote: ... Using TruSeq stranded mRNA kit (Illumina), the fragmented mRNA was reverse transcribed to create the first strand of cDNA with random hexamers and SuperScript™ II Reverse Transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2023Quote: The Nextera library prep kit (Illumina) was used to prepare libraries for WGS resequencing on the Novaseq 6000 sequencer (Illumina) ...
-
bioRxiv - Neuroscience 2024Quote: ... the Truseq Stranded mRNA kit (Illumina) was used with an input of 100-1000 nanograms of total RNA ...
-
bioRxiv - Genomics 2023Quote: ... Tagmentation Library Preparation kit (Illumina 20041795) following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... using the Nextera XT kit (Illumina). Libraries were assessed by Tapestation and Bioanalyzer with a DNA High Sensitivity Chip ...
-
bioRxiv - Immunology 2021Quote: ... DNA libraries were prepared using the Nextera XT DNA Library Preparation Kit and Nextera Index Kit (Illumina) following the manufacturer’s protocol with minor modifications ...
-
bioRxiv - Neuroscience 2021Quote: ... Libraries were prepared using the Nextera XT DNA Sample Preparation Kit and the Nextera Index Kit (Illumina). Multiplexed libraries were pooled and paired-end 150-bp sequencing was performed on the Illumina HiSeq 4000 platform at Sidra Medicine ...
-
bioRxiv - Microbiology 2019Quote: ... rRNA depletion was performed (rRNA depletion Kit Ribo Zero Magnetic Kit for Gram-positive bacteria; Epicentre [Illumina]) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... cDNA was amplified using Ovation V2 kit (NuGEN) and sequencing libraries were generated using NexteraXT kit (Illumina). RNA-seq was carried out on an Illumina HiSeq 4000 ...
-
bioRxiv - Microbiology 2020Quote: ... and libraries were constructed using a kit (NEB Ultra DNA library kit for Illumina; catalogue number E7370L), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Libraries were made using TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold Kit (Illumina). These libraries were sequenced using Illumina HiSeq platform with 100 bp single read at a depth of 10-20 million reads per sample.
-
bioRxiv - Microbiology 2022Quote: ... and libraries prepared using the NexteraXT kit and sequenced using HiSeq 1 × 150-cycle v3 kit (Illumina). The operational taxonomic unit (OTU ...
-
bioRxiv - Genomics 2022Quote: ... the TruSeq Stranded Total RNA Sample Preparation Kit and ScriptSeq v2 RNA-seq library preparation kit (Illumina) were used ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA-seq libraries were generated using TruSeq RNA Access Library Prep Kits (TruSeq RNA Exome kits; Illumina) and sequenced on NextSeq500 sequencers using 75bp paired-end sequencing method (Illumina ...
-
bioRxiv - Immunology 2023Quote: ... for 2 × 250 cycles using MiSeq PE cluster generation kits and MiSeq SBS Kit sequencing reagents (Illumina).
-
bioRxiv - Physiology 2023Quote: ... was purchased from Beckman Coulter. TruSeq PE Cluster Kit v3-cBot-HS kit (cat. PE-401-3001) was purchased from Illumina. Biospin Tissue Genomic DNA extraction Kit (cat ...
-
bioRxiv - Immunology 2023Quote: ... Libraries were prepared using the Nextera XT DNA Sample Preparation Kit and the Nextera Index Kit (Illumina) as per manufacturer instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA-seq libraries were generated using Truseq RNA Access Library Prep Kits (TruSeq RNA Exome kits; Illumina) and sequenced on NextSeq500 sequencers using 75□bp paired-end sequencing method (Illumina ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... using the NextSeq 500/550 High Output Kit v2.5 (300 Cycles) kit (cat. no. 20024908) (Illumina Inc.). The quality of the sequencing outputs was controlled using FastQC version 0.11.9 (Simon ...
-
bioRxiv - Microbiology 2023Quote: ... 500-cycle MiSeq Reagent Kit v2 or 600-cycle MiSeq Reagent Kit v3 (Illumina, California, United States), creating 2 × 150 ...
-
bioRxiv - Cell Biology 2020Quote: ... an oligonucleotide containing the Illumina P7 adaptor sequence was ligated to the 3’ end of the single stranded LAM PCR fragments using Circligase (Epicentre/Illumina, #CL9025K). A P5 adaptor was added by PCR ...
-
bioRxiv - Neuroscience 2020Quote: ... Sequencing libraries (1.3 nM) were chemically denatured and applied to an Illumina NovaSeq flow cell using the NovaSeq XP chemistry workflow (Illumina-20021664). Following transfer of the flowcell to an Illumina NovaSeq instrument ...
-
bioRxiv - Neuroscience 2020Quote: ... The cell solutions were immediately transferred to ice and transported to the Wellcome Trust Centre for Human Genetics (WTCHG) for scRNAseq via 10x genomics chromium (10x genomics, US) (Single Cell 3’ v3) and Illumina hiseq 4000 (Illumina, US). This approach achieved 66-72K mean reads per cell and a sequencing depth of 53-55% per cell before filtering.
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was extracted and sequence reads (100 bp paired-end) were generated with Illumina TruSeq high output version 3 chemistry on a HiSeq 2500 (Illumina, Inc.) at NRC-Plant Biotechnology Institute (NRC-PBI) ...
-
bioRxiv - Immunology 2019Quote: ... CC (third part, forward primer linker) AGMGTTYGATYMTGGCTCAG (fourth part, forward primer) and 338R CAAGCAGAAGACGGCATACGAGAT (first part, reverse complement of 3′ Illumina adaptor) ACGAGACTGATT (second part ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were processed according to the standard 10x Chromium 3’ workflow and pooled before sequencing over two lanes (Illumina HiSeq 4000).
-
bioRxiv - Genomics 2019Quote: ... The resulting libraries always contain dual-indexes in the standard indexing positions and may optionally contain additional internal indexes (Figs. 1–3; Table 1; Illumina, 2018b). These indexes are recovered through the four standard separate sequencing reactions generated by Illumina instruments when doing paired-end sequencing (Fig ...
-
bioRxiv - Genomics 2021Quote: ... and ligated to custom CpG-free annealed adapters (Oligo 3 - Custom CpG-free P7 adapter and Oligo 4 - Custom CpG-free P5 adapter; annealed according to the standard Illumina protocol). The adapter-ligated gDNA was purified and amplified in 20 reactions using KAPA HiFi master mix (Roche ...
-
bioRxiv - Genomics 2021Quote: ... and 1µM Dexamethasone or 0.1% ethanol for 3 hours. Transposition was performed using the OmniATAC protocol (Corces et al. 2017) and the tagment DNA TDE1 enzyme (Illumina, 20034197). DNA was purified using the MinElute PCR purification kit (Qiagen) ...
-
bioRxiv - Cell Biology 2022Quote: The input samples were submitted to the Washington University Genome Technology Access Center to obtain and sequence the cDNA libraries (10XGenomics, 3’v3.1; Illumina NovaSeq S4) according to established protocols ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl of PCR 1 were used as template for PCR 2 (14 cycles) and used forward primers 5’-AATGATACGGCGACCACCGAGATCTACAC-NNNNNNNN-ACACTCTTTCCCTACACGAC-3’ (compatible to Illumina i5) and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 x 105 mESCs and 5 x 104 S2 cells were resuspended in Tagment DNA Buffer and treated with 3 µL TDE1 Tagment DNA Enzyme (Illumina 20034197). After thorough mixing ...
-
bioRxiv - Genomics 2023Quote: For all tandem repeat identification and quantification we used DNA sequences from 2,504 individuals from the Phase 3 of the 1,000 Genomes Project (∼30x coverage Illumina short-read data) (Byrska-Bishop et al ...
-
bioRxiv - Immunology 2024Quote: ... 2024) using the command CreateSeuratObject with the following parameters: min.cells = 3 and either min.features = 200 (for Illumina reads from MBC gate) or min.features = 100 (for the Oxford Nanopore reads from the ASC gate) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... using the HiSeq PE Rapid Cluster Kit v2 and HiSeq Rapid SBS Kit v2 (200 cycles, Illumina, USA) in the 100bp pair-end mode.
-
bioRxiv - Genomics 2021Quote: ... Cluster generation was performed using HiSeq SR Cluster Kit v3 cBot kits (Illumina Inc, San Diego, CA, USA).
-
bioRxiv - Microbiology 2021Quote: DNA libraries were constructed with the Nextera XT Library Preparation Kit and Index Kit (Illumina, San Diego, CA). DNA libraries were pooled and sequenced on both the Illumina HiSeq5000 and HiSeq2500 and fastq files were generated from demultiplexed reads with bcl2fastq Conversion Software (Illumina ...
-
bioRxiv - Genomics 2022Quote: ... and NovaSeq 6000 S4 Reagent Kit v1.5 (200 cycles) or NovaSeq 6000 S4 Reagent Kit v1.0 (100 cycles) (Illumina) following manufacturer instructions ...
-
bioRxiv - Microbiology 2020Quote: DNA libraries were constructed with the Nextera XT Library Preparation Kit and Index Kit (Illumina, San Diego, CA). DNA libraries were pooled and sequenced on both the Illumina HiSeq5000 and HiSeq2500 and fastq files were generated from demultiplexed reads with bcl2fastq Conversion Software (Illumina ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... or the NEBNext Ultra DNA Library Prep Kit for Illumina (formerly NEBNext DNA Library Prep Kit for Illumina; New England Biolabs Inc. ...