Labshake search
Citations for Illumina :
451 - 500 of 9186 citations for Onion Yellow Dwarf Virus OYDV PCR Kits since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... The final PCR products were sequenced by Illumina MiSeq PE300.
-
bioRxiv - Genetics 2020Quote: ... single worm PCR products were analyzed by Illumina sequencing using 2×250 bp pair-end run ...
-
bioRxiv - Biochemistry 2021Quote: ... in an Eco Real-Time PCR System (Illumina). The following thermal cycling profile was used ...
-
bioRxiv - Cell Biology 2020Quote: ... All PCRs were pooled and sequenced by Illumina sequencing (Duke Center for Genomic and Computational Biology (GCB) ...
-
bioRxiv - Genetics 2021Quote: ... and a unique indexed RNA PCR primer (Illumina) per reaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a unique indexed RNA PCR primer (Illumina) per reaction ...
-
bioRxiv - Developmental Biology 2023Quote: ... following Sequencing Protocol provided by Addgene (“Broad Institute PCR of sgRNAs for Illumina sequencing”). Next-generation sequencing was performed from the Molecular Pathology Genomics Core of Children’s Hospital Los Angeles using Illumina HighSeq 2500.
-
bioRxiv - Cell Biology 2023Quote: ... and a unique indexed RNA PCR primer (Illumina) per reaction ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cDNA template was PCR amplified (Illumina barcoding) for 12 cycles and size selected to 225–350 bp length ...
-
bioRxiv - Plant Biology 2024Quote: ... The PCR products were sequenced using HiSeq2500 (Illumina) to generate 100 bp single-end raw reads ...
-
bioRxiv - Plant Biology 2024Quote: ... using an Eco Real-Time PCR system (Illumina). Analysis was performed using the ddCT method with the qRAT tool and limma statistical framework (Flatschacher ...
-
bioRxiv - Bioengineering 2020Quote: ... the V3-V4 hypervariable region of the bacterial 16S rRNA gene pool of the DNA extracts was amplified by PCR using the pair of 341f/806r primers prior to sequencing of PCR products using a HiSeq 2500 sequencer (Illumina, USA). A detailed description of the wet-lab and dry-lab workflows can be found in Supporting Information S5.
-
bioRxiv - Immunology 2021Quote: ... Transposed DNA fragments were purified using Qiagen Mini- Elute Kit and PCR amplified using NEB Next High Fidelity 2x PCR master mix (New England Labs) with dual indexes primers (Illumina Nextera). Genomic Alignment of sequencing reads ...
-
bioRxiv - Cell Biology 2023Quote: The PCR primers introduce the full-length adaptor sequence required for Illumina sequencing (for details see Illumina small RNA PCR primers). PCR was performed in 12.5 μL using half of the ranhexRT sample as a template [1× KAPA HiFi HotStart ReadyMix (KapaBiosystems KK2602) ...
-
bioRxiv - Plant Biology 2024Quote: ... After three rounds of PCR with specific primers (1stPCR: CARMA_3RACE and RTPXT, 2ndPCR: mXTf and mXTr, 3rd PCR: Illumina indexing primers) and cleaning each PCR reaction on AMPure beads ...
-
bioRxiv - Plant Biology 2024Quote: ... The PCR for HRM analysis was performed in High Resolution Melt/DNA binding Dye/DNA/PCR with HRM Curve mode of the Eco real-time PCR system (Illumina Inc.). The PCR conditions were 94°C for 3 min ...
-
bioRxiv - Genomics 2024Quote: ... bidentatus DNA extraction and library preparation was performed by Dovetail Genomics (Scotts Valley, CA, USA) with the TruSeq DNA PCR-Free kit (Trueq Index 5, Illumina, San Diego, CA, USA, mean size 475bp). 150 bp paired-end sequencing was performed on one lane of HiSeqX by Novogene (Cambridge ...
-
bioRxiv - Cell Biology 2022Quote: ... The quantitative 3-step real-time PCR was performed by the Eco Real-Time PCR system (Illumina Inc., San Diego CA, USA) and CFX Connect (Bio-Rad Laboratories AG ...
-
bioRxiv - Genetics 2020Quote: ... The first PCR used universal primers (without Illumina indexes) to amplify the barcodes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The 100 PCR samples were then sequenced by Illumina sequencing platform ...
-
bioRxiv - Microbiology 2022Quote: ... Library preparation (Illumina® TruSeq™ DNA PCR-Free), sequencing and quality checks were done by the Biomics sequencing platform of the Institut Pasteur (C2RT ...
-
bioRxiv - Molecular Biology 2020Quote: ... by PCR amplification using Illumina sequencing adaptor primers (Illumina). Paired-end sequencing was performed on a Hi-Seq 2500 System (University of Georgia Genomics Core ...
-
bioRxiv - Microbiology 2022Quote: ... Library preparation (Illumina® TruSeq™ DNA PCR-Free) and sequencing was done on the C2RT Biomics platform of the Institut Pasteur (using short reads ...
-
bioRxiv - Biochemistry 2021Quote: ... PCR amplicons were purified and sequenced (NextSeq 500, Illumina). Screens were analyzed using Python (v.2.7.13) ...
-
bioRxiv - Biochemistry 2021Quote: ... PCR amplicons were purified and sequenced (NextSeq 500, Illumina). Screens were analyzed using Python (v.2.7.13) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplification followed Earth Microbiome Project recommendations (“16S Illumina Amplicon Protocol ...
-
bioRxiv - Immunology 2021Quote: ... Add 30 μl PCR master mix (2.5 μl Illumina dual indexes primer 1 ...
-
bioRxiv - Immunology 2021Quote: ... PCR products were barcoded and sequenced utilizing MiSeq (Illumina) Nano kit v.2 as described in [84].
-
bioRxiv - Cancer Biology 2022Quote: ... Purified PCR products were sequenced using HiSeq 2500 (Illumina). Bowtie [56] was used to align the sequenced reads to the sgRNA library ...
-
bioRxiv - Genomics 2023Quote: ... (2022) (TruSeq DNA PCR-free libraries sequenced on Illumina NovaSeq6000 ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR products were sequenced with a MiSeq (Illumina) using the reagent kit v3 (PE 2x300 ...
-
bioRxiv - Microbiology 2024Quote: ... which was determined by PCR and confirmed by Illumina whole-genome sequencing for this study.
-
bioRxiv - Genetics 2023Quote: ... using PCR primers ACACTCTTTCCCTACACGACGCTCTTCCGATCTGCAGAAGCAGCTCGACGC and GACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCAGCTGCCGGAAGTGCT (Illumina adapters underlined) and Phire DNA polymerase (Thermofisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... purified transposed DNA was PCR amplified using Nextera (Illumina) i5 common adapter and unique i7 index adapters and NEBNext High Fidelity 2x PCR Master Mix for 5 cycles with the following program ...
-
bioRxiv - Neuroscience 2024Quote: Libraries were prepared using TruSeq DNA PCR-Free (Illumina) and were sequenced with 150-base-pair paired end reads on an Illumina HiSeq 4000 ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse and forward amplicon PCR primers recommended by Illumina were used (16s Amplicon PCR Forward Primer= TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG ...
-
bioRxiv - Cancer Biology 2023Quote: ... Purified PCR products were sequenced using HiSeq 2500 (Illumina). Bowtie [82] was used to align the sequenced reads to the sgRNA library ...
-
bioRxiv - Molecular Biology 2024Quote: ... Amplicons were indexed by PCR using Nextera indexes (Illumina), quantified with Qubit dsDNA High Sensitivity Assay kit (Invitrogen) ...
-
bioRxiv - Bioengineering 2024Quote: ... Amplicons were indexed by PCR using Nextera indexes (Illumina), pooled in equimolar concentrations ...
-
bioRxiv - Microbiology 2024Quote: ... RiboZero kit Microbiome kit (Illumina) was used to eliminate ribosomal RNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... The PCR-amplified cDNA was purified using AMPure XP beads and processed with the Nextera XT DNA Library Preparation Kits (Illumina, Cat. # FC-131-1024 and FC-131-1096) as per the protocol provided by the manufacturer.
-
bioRxiv - Cell Biology 2023Quote: ... qRT-PCR was conducted using AceQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) on an RT-PCR system (Illumina Eco, California, USA). The primers used are listed in Table 1 ...
-
bioRxiv - Evolutionary Biology 2024Quote: Library preparation and sequencing - DNA from 15 clones was used to prepare PCR-free paired-end sequencing libraries (Illumina DNA Prep PCR free) with an insert size of ∼300bp ...
-
bioRxiv - Genetics 2021Quote: ... DNA was PCR-amplified with TruSeq dual indexing primers (Illumina) to generate Illumina compatible libraries ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... followed by tailed-PCR using Nextera XT Index Primers (Illumina) (S1B Fig) ...
-
bioRxiv - Microbiology 2021Quote: ... by 7 cycles PCR (16S Metagenomic Sequencing Library Preparation, Illumina). The amplicon libraries were purified using Agencourtusing the Agencourt AMPure XP system (Beckman) ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products were then quantified and sequenced using MiSeq (Illumina).
-
Genomic bases of insularity and ecological divergence in barn owls (Tyto alba) of the Canary IslandsbioRxiv - Evolutionary Biology 2022Quote: ... and individually tagged 100bp TruSeq DNA PCR-free libraries (Illumina) were prepared according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... PCR amplification was performed in a 48 well plate (Illumina) on an Eco machine (Illumina) ...
-
bioRxiv - Cancer Biology 2021Quote: ... PCR amplicons were then sequenced on a NextSeq 500 (Illumina). Guide scores were calculated as median log2 fold change in the abundance between the initial and final population of that sgRNA similar to standard CRISPR screens ...