Labshake search
Citations for Illumina :
451 - 500 of 1852 citations for 7 Benzyloxy 3 4 dihydro 1H naphthalen 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: Four 3’ PCR primers were used each containing a unique index (underlined) recognized by Illumina:
-
bioRxiv - Synthetic Biology 2022Quote: ... adding barcodes to identify the sample (primers P3-P15 in Supplementary Table 3, containing Illumina Nextera tagmentation adapters and ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Biochemistry 2023Quote: ... mRNA libraries were prepared using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina). Quality of mRNA libraries was determined using Agilent Tape Station and mRNA was sequenced at 75 bp single read sequencing using NextSeq 500 (Illumina).
-
bioRxiv - Developmental Biology 2021Quote: ... 4 nM 10X scATAC-seq library was sequenced on a NextSeq500 platform (Illumina) using NextSeq 500/550 High Output Kit v2.5 (75 Cycles ...
-
bioRxiv - Developmental Biology 2021Quote: ... 4 nM 10X scRNA-seq libraries were sequenced on a NextSeq500 platform (Illumina) using NextSeq 500/550 High Output Kit v2.5 (150 Cycles ...
-
bioRxiv - Genomics 2019Quote: ... we combined the purified cDNA with 4 µl of Nextera TD buffer (Illumina) and 1 µl of Nextera Tn5 enzyme (Illumina ...
-
bioRxiv - Biophysics 2022Quote: ... The sequencing (Step 4) was performed using a Hi-Seq sequencer (Illumina, US) and the data was then filtered using the framing sequence ACAC with a quality score larger then 20 and analyzed (Step 5 ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 ATAC-seq libraries were sequenced per lane in HiSeq 2500 System (Illumina) to generate paired-end 50-bp reads ...
-
bioRxiv - Genetics 2019Quote: Genomic DNA of three samples (mother, father and patient) was enriched by using the TruSight One (TSO) Next-Generation Sequencing (NGS) Panel (Illumina, Inc. San Diego, CA, USA), which includes 125,395 probes targeting a 12-Mb region spanning ~62,000 target exons of 4,811 genes ...
-
bioRxiv - Genomics 2021Quote: ... One RNA-seq library was constructed for each tissue using the NEBNext® Ultra™ || Directional RNA Library Prep Ki (Illumina, San Diego, Calif., USA) and sequenced with a 2 × 100bp (paired-end ...
-
bioRxiv - Genetics 2022Quote: ... then pooled them and sequenced the 2×75 bp paired-end libraries on one Flowcell of an Illumina NextSeq 550 with a High Output v2 kit (150 cycles) (Illumina Inc., San Diego, California, USA).
-
bioRxiv - Genomics 2022Quote: ... SW-8046-2) from libraries prepared using the Nextera XT DNA kit (Illumina, Inc, San Diego, CA, and sequenced on Illumina HiSeq4000 (2×150 bp). WGS data was obtained from six C ...
-
bioRxiv - Cancer Biology 2022Quote: ... generating 2 × 75 base read pairs or on a NovaSeq 6000 generating 2 × 150 base read pairs using standard settings (Illumina, San Diego, CA, USA). BCL output from the sequencing platform was converted to FASTQ using Illumina’s bcl2fastq tool (versions 2.17 to 2.20 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Sequencing (Illumina HiSeq 2500, 2 × 50 bp paired-end reads) was performed in the MSKCC Integrated Genomics Operation ...
-
bioRxiv - Microbiology 2019Quote: ... using the v2 2×250 base-pair kit (Illumina, Inc.). Positive/negative controls were included for DNA extraction and amplification.
-
bioRxiv - Plant Biology 2020Quote: ... MiSeq 2×250 bp sequencing (Illumina, San Diego, CA, USA) was performed at the University of Florida’s Interdisciplinary Center for Biotechnology Research.
-
bioRxiv - Microbiology 2020Quote: ... and submitted for 2-by 250-bp Miseq sequencing (Illumina) to the DNA Technologies and Expression Analysis Cores at the UC Davis Genome Center (supported by NIH Shared Instrumentation Grant 1S10OD010786-01).
-
bioRxiv - Microbiology 2021Quote: ... with 2 × 150 bp and a MiSeq reagent V2 (Illumina).
-
bioRxiv - Microbiology 2019Quote: ... Illumina MiSeq 2×250bp paired-end sequencing (Illumina V2 chemistry) was performed in the Transcriptome and Genome Analysis Laboratory at the University of Göttingen in accordance with published guidelines (32) ...
-
bioRxiv - Microbiology 2022Quote: ... and further Mi-Seq 2×300 bp paired-end (Illumina) 16S rRNA sequencing of the V3 and V4 regions (23 ...
-
bioRxiv - Plant Biology 2023Quote: ... and paired-end sequenced (2×150bp) with a HiSeq3000 (ILLUMINA).
-
bioRxiv - Microbiology 2023Quote: Paired end 2×250 bp reads were generated from Illumina sequencing on a NovaSeq SP 250PE at the QB3 facility ...
-
bioRxiv - Genomics 2023Quote: ... The library was sequenced on NovaSeq 6000 (Illumina, 2×151bp) following the manufacturer’s protocol for dual indexing.
-
bioRxiv - Genomics 2023Quote: ... The library was sequenced on NovaSeq 6000 (Illumina, 2×151bp) following the manufacturer’s protocol for dual indexing ...
-
bioRxiv - Microbiology 2024Quote: ... pooled and sequenced on MiSeq (Illumina, 2 x 250 bp) using the MiSeq reagent kit v2 (500 cycles).
-
bioRxiv - Cancer Biology 2022Quote: ... We prepared barcoded libraries for each sample and then pooled the libraries to perform asymmetric 400 + 100 bp paired-end IgSeq in one run using Miseq Reagent Kit V3 (Illumina, Miseq Reagent Kit V3, 600-cycles) on Illumina MiSeq platform.
-
bioRxiv - Cell Biology 2021Quote: ... and 3 cycles of PCR for incorporation of unique dual indices (NEBNext multiplex oligos for Illumina) to the final libraries ...
-
bioRxiv - Cancer Biology 2021Quote: ... Both libraries were prepared using the QuantSeq 3′ mRNA-Seq Library Prep Kit FWD from Illumina, following the standard protocol ...
-
Three Distinct Transcriptional Profiles of Monocytes Associate with Disease Activity in SSc PatientsbioRxiv - Genomics 2022Quote: ... Both full-length and 3’ RNA- seq libraries were sequenced on a NextSeq 500 instrument (Illumina) with 5-10 x 106 aligned reads per sample ...
-
bioRxiv - Cancer Biology 2022Quote: ... We diluted the final library to 3 nM concentration and used a HiSeq PE150 sequencer (Illumina) to perform the sequencing.
-
bioRxiv - Cell Biology 2019Quote: ... COX4I2 and 3’ end of ID1 (green fluorescently labelled BAC (RP5-857M17) provided by BlueGnome (Illumina)) and the 20q telomere probe the TelVysion 20q Spectrum Orange (Cat ...
-
bioRxiv - Genomics 2019Quote: ... The sequencing was conducted on the MiSeq reagent v.3 600 cycles (Illumina, San Diego, CA). The four genomes were assembled using ngs_mapper v1.5 ...
-
bioRxiv - Genomics 2021Quote: ... and dual-indexed 3’ digital gene expression (DGE) sequencing libraries were prepared using Nextera XT (Illumina). Libraries were sequenced on a NovaseqS4 or NovaseqS2 with a paired end read structure (R1 ...
-
bioRxiv - Genetics 2020Quote: ... 3 groups in total) and constructed using the Illumina TruSeq Stranded Small RNA Sequencing kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Paired- end single cell 3’ gene expression libraries were sequenced on a Novaseq 6000 System (Illumina) using a NovaSeq S1 flow-cell to a depth of at least 3.5 × 108 reads/timepoint.
-
bioRxiv - Microbiology 2022Quote: ... and 3 μg of the product was processed using the TruSeq RNA Sample Preparation Kit (Illumina). Purification of mRNA was performed using polyT oligo-attached magnetic beads ...
-
bioRxiv - Genomics 2023Quote: scRNA-seq library preparation was performed using 10x Genomics Chromium 3’ single cell library protocol (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... as well as 6 PCR negative control and 3 extraction negatives on a NovaSeq 6000 (Illumina), with 2 Gb requested per sample.
-
bioRxiv - Developmental Biology 2023Quote: ... 3’ RNA-seq (Bulk MARS-seq91,135) libraries were prepared and sequenced on a Novaseq 6000 (Illumina) at the Weizmann Crown Institute for Genomics ...
-
bioRxiv - Genomics 2019Quote: Libraries were subjected to 2×100 bp paired-end sequencing on a HiSeq 2500 or 2×150 bp a HiSeq 4000 instrument (Illumina, San Diego, California, United States), to a mean sequencing depth of 87X for CLL (range 34X-129X) ...
-
bioRxiv - Molecular Biology 2021Quote: ... libraries from amplicons 1–4 were mixed with 5% PhiX DNA control library (Illumina) and sequenced ...
-
bioRxiv - Cell Biology 2022Quote: ... All CORALL generated libraries were sequenced in parallel on 4 Novaseq S4 lanes (Illumina). RNA sequencing libraries for the differential sedimentation speed based cell fractionation experiment were performed using QuantSeq 3’ mRNA-Seq kit (Lexogen ...
-
bioRxiv - Microbiology 2020Quote: ... Libraries were diluted to 4 nM and sequenced on a NextSeq 500 sequencer (Illumina) with a NextSeq 500 High-Output Kit v2 (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... then 4 pM of the pooled library with 5% PhiX v3 control (Illumina, USA) was loaded onto an Illumina MiSeq instrument and sequenced using MiSeq V3 chemistry ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl each of Nextera N7 and S5 barcoding primers (Illumina), 1 μl purified template ...
-
bioRxiv - Molecular Biology 2020Quote: ... We then performed 2×250 bp paired-end MiSeq sequencing (Illumina).
-
bioRxiv - Immunology 2019Quote: ... and paired end-sequenced (2×75bp) on the HiSeq 2500 (Illumina). Demultiplexing was performed using CASAVA software (Illumina ...
-
bioRxiv - Genomics 2019Quote: ... and sequenced using a MiSeq V2 2×500 reagent kit (Illumina) which was sufficient to overlap and assemble the forward and reverse reads ...
-
bioRxiv - Genomics 2019Quote: ... and sequenced using a MiSeq V3 2×600 reagent kit (Illumina).