Labshake search
Citations for Bioline :
251 - 300 of 480 citations for ssc mir 369 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... containing 50 μl of 2x PCR BioMix™ (Bioline, London, UK), 5 pmol of both forward and reverse primers ...
-
Virus-mediated transient expression techniques enable genetic modification of Alopecurus myosuroidesbioRxiv - Genetics 2020Quote: ... or Isolate II PCR and Gel Kit (Bioline cat# BIO-52059) according to the manufacturer’s protocols ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... With a standard qualitative PCR (0.125 My Taq™ polymerase (Bioline), 5μl 5x buffer ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... with a MyTaq HS Red Mix PCR kit (Bioline, Eveleigh, Australia). Each 20 μL reaction contained 5 μL of MilliQ water ...
-
bioRxiv - Immunology 2021Quote: ... The PCR reactions were assembled using 45 μL master mix (Bioline) containing 2x buffer ...
-
bioRxiv - Microbiology 2021Quote: ... Real-time PCR was performed using SensiFAST SYBR & Fluorescein Kit (Bioline) as previously described (25,32) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Routine PCR genotyping of was performed using MyTaq Red mix (Bioline) and using the mentioned primers in 1:0.5:1 combination ...
-
bioRxiv - Genomics 2021Quote: ... PCR amplification of DpnII-digested fragments using MyTaq (Bioline, BIO-21112) enriched for methylated fragments before samples were sonicated and prepped for sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... containing 12.5 µl of 2X BioMix PCR master mix (Bioline, UK), 0.75 µl of 0.3 µM forward and reverse primer (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... and used to perform a SYBR-based real-time PCR (BioLine) with primers (Table 1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... For real-time PCR SYBR Green Master mix (Bioline BIO-94020) was used ...
-
bioRxiv - Immunology 2022Quote: ... Final PCR products were cleaned with 0.8V JetSeq Clean Beads (Bioline) and PCR yield measured with a Quant-it PicoGreen ds DNA assay (ThermoFisher) ...
-
bioRxiv - Immunology 2022Quote: ... Quantitative PCR was performed using 2X Taq-based Master Mix (Bioline) and TaqMan gene expression assays (Applied Biosystems) ...
-
bioRxiv - Immunology 2020Quote: ... qRT-PCR was done using 2X Taq-based Master Mix (Bioline) and TaqMan gene expression assays (Applied Biosystems) ...
-
bioRxiv - Microbiology 2019Quote: ... PCR reagents included MyTaq Red Mix 1x (Bioline, UK, BI0-25043), ttr-4 reverse primer (5’-AGCTCAGACCAAAAGTGACCATC-3’ ...
-
bioRxiv - Microbiology 2019Quote: ... PCR products were visualised using agarose gel (3.5%) (Bioline, BIO-41025) electrophoresis in TAE buffer ...
-
bioRxiv - Developmental Biology 2020Quote: ... qRT-PCR was performed using SensiMix SYBR low-ROX kit (Bioline) on a QuantStudio5 machine (Thermo Fisher) ...
-
bioRxiv - Immunology 2021Quote: ... and quantitative PCR was run using SensiFAST Sybr Master Mix (Bioline). The primers used to detect GFP were a1 5′-caagggcgaggagctgttca-3′ and 5′-tgaacttgtggccgtacgtcg-3′ (GFP7) ...
-
bioRxiv - Microbiology 2022Quote: ... PCR reactions were performed using MyTaq™ Red DNA Polymerase (Bioline) in a Bio-Rad® thermocycler with the following program ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products visualized by electrophoresis on 2% agarose (Bioline, London, UK) gel stained with SYBR Safe (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... The targeted region was amplified by PCR (MyTaq Red mix, Bioline) from 100 ng of genomic DNA ...
-
bioRxiv - Genomics 2023Quote: ... Quantitative PCRs were performed using the SensiFAST SYBR NoROX Kit (Bioline) and analyzed on a light cycler rapid thermal system (LightCycler®480 2.0 Real time PCR system ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR reactions were done using 2x SensiFAST Mix (Bioline, London, UK) and analysed in a Lightcycler 480 II (Roche ...
-
bioRxiv - Developmental Biology 2023Quote: ... For real-time PCR SYBR Green Master mix (Bioline BIO-94020) was used ...
-
bioRxiv - Molecular Biology 2023Quote: ... Routine PCR genotyping of was performed using MyTaq Red mix (Bioline) and using the mentioned primers in 2:1:1 combination ...
-
bioRxiv - Immunology 2024Quote: ... Quantitative PCR was performed using 2X Taq based Master Mix (Bioline) and Taq Man gene expression assays (Applied Biosystems) ...
-
bioRxiv - Immunology 2023Quote: ... and a quantitative PCR was performed using SensiFast SYBR (Bioline, 98020) and Bio-Rad CFX Connect thermocycler ...
-
bioRxiv - Cancer Biology 2023Quote: Barcode amplification by PCR was performed using 2x Accuzyme mix (Bioline) and 10 ng of the extracted DNA/cDNA using the primers below (10μM):
-
bioRxiv - Physiology 2021Quote: ... was performed with three primers (Figure 1 A, “a”: AAGGCGCATAACGATACCAC, “b”: TACAATGCAGGCTCCAAACAC, “c”: CGAGCACAGGAAGTTCAACA, Eurofins Genomics, Ebersberg/Germany) and the ImmoMix™ kit (Bioline, Cat. No BIO-25020) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2021Quote: ... For the semi-quantitative end-point PCRs the MyTaq Red Mix (Bioline) was used ...
-
bioRxiv - Molecular Biology 2021Quote: ... Real-time PCR analysis was carried out using SYBR Green mix (Bioline) in a Bio-Rad CFX-100 RT-qPCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... Quantitative PCR was performed in technical duplicates using SensiMix SYBR mix (Bioline). The U6 snRNA gene was used as an internal control.
-
bioRxiv - Cancer Biology 2019Quote: ... Quantitative PCR was performed using the SensiFAST SYBR Hi-ROX kit (Bioline) and an AriaMX Real Time PCR system (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: ... Quantitative PCR was performed with the SensiFAST SYBR Hi-ROX Kit (Bioline) using a StepOnePlus 96-well plate reader (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2022Quote: ... real-time PCR cycler with SensiFAST SYBR master mix (Bioline BIO-98050) using primers for target genes and 18S rRNA or phosphoglycerate kinase (PGK ...
-
bioRxiv - Physiology 2022Quote: ... and quantitative PCR was performed using SensiFAST SYBR reagent (Bioline, #BIO-98020). Transcript abundance was normalized using Ywhae as a reference gene ...
-
bioRxiv - Microbiology 2022Quote: ... The quantitative PCR was performed with SensiFAST SYBR Lo-ROX Kit (Bioline), 0.2uM forward and reveres primer ...
-
bioRxiv - Cell Biology 2022Quote: ... A PCR reaction consisted of SensiMix SYBR No-ROX (Bioline, QT650-20), 250nM of forward and reverse primers (Integrated DNA Technologies ...
-
bioRxiv - Genetics 2021Quote: ... purified using PureLink Quick Gel Extraction and PCR Purification Combo Kit” (Bioline) and eventually Sanger sequenced to finally prove their identity and the back-splice junction ...
-
bioRxiv - Genomics 2022Quote: ... PCRs were performed using MyTaq HS DNA Polymerase (Bioline, Cat#: BIO-21111). Reaction mixes contained 5μL 5× MyTaq Reaction Buffer ...
-
bioRxiv - Zoology 2019Quote: ... PCR solutions for each marker contained 0.5U MyTaq HS Mix polymerase (Bioline), 1 μL of DNA template ...
-
bioRxiv - Genomics 2021Quote: ... The PCR was performed using the MyTaq HS mix (Bioline, BIO-25045) - or the Q5 polymerase (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... then purified by ISOLATE II PCR and Gel Kit (Bioline #BIO-52059) or the Exo-Cip Rapid PCR Cleanup Kit (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Quantitative PCR was performed using the SensiFAST Sybr Low Rox kit (Bioline) with specific primers listed in Table S2 ...
-
bioRxiv - Genetics 2022Quote: PCR reactions were routinely performed with VELOCITY DNA Polymerase (Bioline, London, UK) using an MJ Mini Personal Thermal Cycler (Bio-Rad ...
-
bioRxiv - Genetics 2022Quote: ... Quantitative PCR was performed on the diluted cDNA using SensiFast probe (Bioline) as per manufacturers’ protocol with β-actin acting as an endogenous reference ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR amplifications were carried out using the SensiFast SYBR Lo-Rox (Bioline) mix and they were monitored in real time with a 7500 Real Time PCR System (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative PCR was performed using the SensiFAST SYBR No-ROX kit (Bioline) according to the manufacturer’s protocol and the LightCycler480 Instrument II (Roche ...
-
bioRxiv - Systems Biology 2023Quote: ... 14 PCR cycles were performed using MyTaq Red Mix (#BIO-25043; Bioline), yielding 30 µg of barcodes ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR was performed with 20 µl Mango Mix™ (Bioline, UK), 0.25 µM of each primer and 2 µl of DNA template in a final volume of 40 µl with nuclease free water (Ambion ...