Labshake search
Citations for Bioline :
501 - 550 of 951 citations for ssc mir 299 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... assays and SensiFAST™ Probe Hi-ROX Kit (Bioline) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: The Tetro cDNA Synthesis Kit (Bioline; BIO-151 65043) was used to transcribe mRNA into cDNA according to the manufacturer’s manual ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative PCR assays were carried out in the 7500 Real Time PCR System from Applied Biosystems using SensiFAST SYBR Lo-ROX Kit (BioLine, London, UK) and primers previously described [7 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and cDNA synthesized using SensiFAST cDNA synthesis kit (Bioline). Samples were then amplified against transcripts by qRT-PCR with SYBR green ...
-
bioRxiv - Microbiology 2021Quote: ... The resulting PCR products from slurry and syringe method control samples were purified as follows: 30 μl of PCR product per sample was mixed with 6 μl 5X loading dye (Bioline, London, UK) and separated using a 1.5% agarose gel stained with SYBR Safe DNA gel stain (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: All PCRs were carried out in 25 μl reaction volumes containing 0.05 units of MyTaq™ DNA Polymerase (Bioline Laboratories, London, UK), 1x MyTaq™ Mix (Bioline ...
-
bioRxiv - Neuroscience 2022Quote: ... a first-round PCR was carried out using 200 ng of template cDNA with My Taq DNA polymerase (Bioline Alexandria, NSW, Australia), initial denaturation at 95°C for 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... SdhC and SdhD was performed with primers listed in Table 2 and the following reaction conditions: PCR amplification used MyTaq DNA Polymerase (Bioline, London, UK), with 0.25 μM each forward and reverse primer ...
-
bioRxiv - Plant Biology 2020Quote: ... SYBR Green reaction mix (Bioline; Sensimix SYBR No-ROX kit) was used in a Bio-Rad CFX384 real-time system for qPCR ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR was performed using SensiFast SYBR Hi-ROX kit (Bioline) on CFX96 Touch Real-Time PCR System (Bio-Rad) ...
-
bioRxiv - Genetics 2021Quote: ... and cDNA was prepared with Tetro cDNA Synthesis kit (Bioline). qPCR was performed on Applied Biosystems ViiA™ 7 Real-Time PCR System with Sybr Green ...
-
bioRxiv - Neuroscience 2022Quote: ... or the ISOLATE II RNA Mini Kit (Bioline, BIO-52073). Isolated RNA was reverse transcribed using the SensiFAST cDNA Synthesis Kit (Bioline ...
-
bioRxiv - Genomics 2020Quote: ... and converted to cDNA using Tetro cDNA synthesis kit (Bioline) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... and reverse transcribed using the SensiFAST cDNA synthesis kit (Bioline), according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2020Quote: ... cDNA was transcribed using the SensiFAST cDNA Synthesis Kit (Bioline). Naïve and primed marker expression was determined by qPCR using the Sensifast SYBR No Rox-Kit (Bioline) ...
-
bioRxiv - Cell Biology 2020Quote: ... using the Sensifast SYBR No Rox-Kit (Bioline, BIO-98020). Expression levels were normalized to either L32 or Actin ...
-
bioRxiv - Cell Biology 2020Quote: ... The Sensifast SYBR no-rox Kit (ref. BIO-98005, Bioline) and a Rotor Gene Q Real-Time PCR (Qiagen ...
-
bioRxiv - Bioengineering 2020Quote: ... using the SensiMix™ Kit and SYBRGreen (Bioline, Luckenwalde, Germany). For each triplicate cDNA amounts corresponding to 50 ng RNA were used and measurements were conducted in a LightCycler® 480 (Roche ...
-
bioRxiv - Cancer Biology 2020Quote: ... and SensiMix SYBR No-ROX Kit™ (Bioline, QT650-20), using RPLP0 as a reference gene ...
-
bioRxiv - Cell Biology 2021Quote: ... and the SensiFAST™ SYBR® No-ROX Kit (Bioline), following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNAs were prepared using the SensiFAST cDNA Synthesis Kit (Bioline). Quantitative real-time PCR reactions using cDNA samples as template were carried out using a SensiFAST SYBR No-ROX Kit (Bioline ...
-
bioRxiv - Cancer Biology 2020Quote: ... qPCRs were run using SensiFAST SYBR No-ROX Kit (Bioline) and a Roche LightCycler 384 ...
-
bioRxiv - Plant Biology 2021Quote: ... with the SensiMix Kit and SYBR Green (Bioline, Luckenwalde, Germany). Negative controls without template addition ...
-
bioRxiv - Neuroscience 2021Quote: ... 5μl SensiFAST SYBR Green No-ROX Kit (BIOLINE, BIO-98020), and 2μl of DNAse/RNAse-free water ...
-
bioRxiv - Microbiology 2021Quote: ... 125nM) and SensiFAST Probe Hi-ROX One-Step Kit (Bioline) according to the manufacturer’s instructions in a 20μl reaction with 5μl sample ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA preparation was performed using SensiFAST cDNA Synthesis Kit (Bioline) and real-time qPCR was performed using SensiFast SYBR Lo-ROX kit (Bioline) ...
-
bioRxiv - Microbiology 2020Quote: ... The Sensi-FAST SYBR Hi-ROX One-Step Kit (Bioline) was used for quantitative real time PCR (qRT-PCR) ...
-
bioRxiv - Physiology 2020Quote: ... SensiFAST™ SYBR® Lo-ROX Kit (Bioline, TN, USA) was used to amplify cDNA using primers listed in Table S2 ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was reverse transcribed using SensiFast cDNA Synthesis Kit (Bioline), and SYBR green PCR analysis was performed using Kapa HiFi HotStart Ready Mix (Roche ...
-
bioRxiv - Physiology 2019Quote: ... reagent and ISOLATE II RNA Mini kit (Bioline, #BIO-52073). Isolated RNA was reverse transcribed using iScript cDNA Synthesis Kit (Biorad ...
-
bioRxiv - Cancer Biology 2019Quote: ... and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: RNA was isolated using ISOLATE II RNA Mini Kit (Bioline) according to the manufacturers’ instructions with minor adjustments ...
-
bioRxiv - Microbiology 2021Quote: ... braarudii cells using the Isolate II RNA Mini Kit (Bioline) with on column DNA digestion ...
-
bioRxiv - Microbiology 2021Quote: ... with Sensi-FAST Probe Hi-ROX qPCR kit (Bioline, 82005) (8).
-
bioRxiv - Immunology 2021Quote: ... using the SensiFAST SYBR No-ROX Kit (Bioline, Meridian Bioscience). Hprt1 was used as a housekeeping gene and the standard curve method was used for quantification ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was recovered using a DNA purification kit (Bioline #52060). The binding levels of Gal4 and TBP were determined using qPCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... The protocol used the SensiFAST No-ROX kit (Bioline #98020) and a LightCycler 480 system for detection ...
-
bioRxiv - Microbiology 2022Quote: ... was extracted using genomic DNA extraction kit (Bioline, London, UK) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was synthesized using the SensiFast cDNA synthesis kit (Bioline) and SETD7 and GAPDH levels measured by qPCR were used as positive and negative control respectively ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was reverse transcribed by Tetro cDNA synthesis kit (Bioline) with the primer of ‘GAGCAAAGACCCCAACGAGA’ targeting MBaMV-GFP genome ...
-
bioRxiv - Immunology 2023Quote: ... RNA was isolated using ISOLATE II RNA Mini Kit (Bioline) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... qPCR was performed using the SensiFAST SYBR NoROX Kit (Bioline) supplemented with 0.2μM of specific primer pairs (Table S9 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Reactions were performed with SensiFAST SYBR Hi-ROX kit (Bioline), and all samples and negative controls were run in technical duplicate on an Applied Bioscience StepOnePlus qPCR machine (Life Technologies).
-
bioRxiv - Cell Biology 2023Quote: ... and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline). Gene expression was measured using qRT-PCR using TaqMan (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline). Gene expression was measured using qRT-PCR using TaqMan (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was isolated using Isolate II RNA Mini Kit (Bioline) and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline) ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA was generated using the Tetro cDNA Synthesis Kit (Bioline) and the Uni12 primer (5’-AGCAAAAGCAGG-3’ ...
-
bioRxiv - Neuroscience 2023Quote: ... and reverse transcribed using the SensiFast cDNA Synthesis Kit (Bioline). Quantitative real-time PCR was performed in triplets for each sample using the LightCycler DNA Master SYBR Green I Kit in a LightCycler 480 System (Roche) ...
-
bioRxiv - Cell Biology 2023Quote: ... and cDNA was synthesized using a SensiFast cDNA kit (Bioline) using manufacturer’s instructions from 250 ng of RNA ...
-
bioRxiv - Developmental Biology 2024Quote: ... using the Sensifast SYBR no Rox kit (Bioline, BIO-98020). Data analysis and visualisation was performed using Microsoft Excel (Office 365 ...