Labshake search
Citations for Bioline :
401 - 450 of 480 citations for rno mir 32 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... conventional PCR assays were replaced with qPCR assays with SensiFAST™ SYBR® No-ROX Kit (Bioline, Australia). The cycling conditions included an initial denaturation at 95°C for 3 min followed by 28 -40 cycles of 95°C for 5 sec ...
-
bioRxiv - Cancer Biology 2022Quote: ... transcripts were amplified directly on RNA samples using a one-step qRT-PCR kit with SYBR green (Bioline). Primers used against DDIT3 (CHOP ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR products were visualised by electrophoresis in TAE buffer on a 1.5% agarose gel (Bioline, London, UK) stained with 1x SYBR Safe (Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2022Quote: Electrophoresis of the Round 2 Multiplex-Nested-PCR product was performed on a 1% agarose (Molecular grade, Bioline) gel ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR products were size separated by gel electrophoresis on a gel composed of 2% DNA grade agarose (Bioline) in TAE buffer (40 mM Tris Acetate ...
-
bioRxiv - Cancer Biology 2023Quote: ... Genotyping PCR on genomic DNA was performed using the MyTaq DNA Polymerase system (Bioline, cat. no. BIO-21105). Briefly ...
-
bioRxiv - Molecular Biology 2023Quote: ... Correct sized amplicons were then purified using an Isolate II PCR and Gel Kit (Bioline, Meridian Biosciences, Australia) following the manufacturer’s instructions for PCR clean-up and sent for Sanger sequencing at the Victorian Clinical Genetics Services (VCGS ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR reactions were carried out using 1.5 mM MgCl2 and 1X NH4 buffers for 1U of BioTaq polymerase (Bioline), 0.2 mM dNTP mix ...
-
bioRxiv - Plant Biology 2020Quote: ... Real-time PCR reactions were performed in a 384-well microlitre using SensiFAST SYBR® No-ROX Kit (Bioline). The primers used here were designed using the open-source program QuantPrime-qPCR primer designed tool (Arvidsson et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... The genomic regions flanking the nuclease target sites were PCR amplified using MyTaq™ DNA Polymerase (Bioline, https://www.bioline.com/) and primers listed on Table S3 ...
-
bioRxiv - Microbiology 2021Quote: ... 2μL were used as template for genomic PCRs in a 50 μL reaction with Velocity DNA Polymerase (Bioline#21098) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... A CCDC26 exon 6 DNA template was generated by performing a PCR using Red Mix (Bioline, Cat. No. BIO25043) WT K562 cDNA and CCDC26-specific primers that incorporated a T7 RNA polymerase promoter at the 5’-end of the DNA strand to be later transcribed (Supplementary Table 1) ...
-
bioRxiv - Microbiology 2019Quote: ... with total reaction volume of 10 μl containing 5 μl Rotor-Gene SYBR® Green PCR Kit (Bioline, Australia), 0.3 μl each of 10 μM forward and reverse primer and 2 μl of genomic DNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... The relative amount of mRNA transcripts was measured by real-time PCR using SensiFAST SYBR N-ROX Kit (Bioline) and calculated by Bio-Rad CFX Manager Software ...
-
bioRxiv - Microbiology 2023Quote: ... The qRT-PCR reaction was performed using 35 μL SensiFAST™ Probe LoROX One-Step Kit (Bioline, Taunton, MA) and 15 μL of extracted eluate ...
-
bioRxiv - Synthetic Biology 2022Quote: ... PCR was performed (10 cycles) to amplify the tagmented DNA with sequencing adapters using 2x MyTaq (BIO-25041; Bioline). The PCR products were cleaned using Serapure beads and pooled together prior to sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... qRT-PCR analysis was performed in triplicate on 50 ng of cDNA using the SensiFAST SYBR & Fluorescein kit (Bioline) with a Roche Lightcycler 96 ...
-
bioRxiv - Genomics 2023Quote: ... the k13 and pfcrt loci was amplified directly from recrudesced infected blood using the MyTaq Blood-PCR Kit (Bioline) (68) ...
-
bioRxiv - Cancer Biology 2023Quote: For each reaction 1μL of gDNA solution was suspended in a PCR tube with 2μL of MyTaq red reaction buffer (5x; Bioline), 1µL of pooled primers/oligonucleotides (final concentration of each primer 10μM or 5μM for Ubc-Cre) ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was used to analyse differences in gene expression by qRT-PCR employing SensiMix SYBR low-Rox KIT (Bioline, Germany) along with gene specific forward and reverse primers (250 nM ...
-
bioRxiv - Cell Biology 2020Quote: ... The relative amount of PAK transcript variants was measured by quantitative real-time PCR (qPCR) using SensiFAST SYBR No-ROX Kit (Bioline) and calculated using Bio-Rad CFX Manager Software ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Telomere length was measured using real-time quantitative PCR (qPCR) and a SensiMix SYBR No-ROX Kit (Bioline, Sydney, Australia). The telomere primers used were Tel1b (5’-CGGTTTGTTTGGGTTTGGGTTT GGGTTTGGGTTTGGGTT-3’ ...
-
bioRxiv - Genetics 2020Quote: ... CpGs 4-8 (F– TTTAGTAGAGGAAATAAAATAGTAGAAAAA-Biotinylated; R: CCCCAAAAAACCACAAAACCTA) CpGs 9-11 (F – GGATGGAGGAATTTTTTTGTGTT; R: CCCCAAAAAACCACAAAACCTA -Biotinylated) using MyTaq HS mix PCR reagents (Bioline). Amplicons were processed on the Qiagen Q24 Workstation and sequenced in duplicate on the Qiagen Q24 pyrosequencer using the sequencing primers CpGs 4-8 (AACAATTTAAACAAAAAATAACATT ...
-
bioRxiv - Plant Biology 2020Quote: ... Quantitative real-time PCR reactions using cDNA samples as template were carried out using a SensiFAST SYBR No-ROX Kit (Bioline) in a CFX96 Touch (BIO-RAD ...
-
bioRxiv - Neuroscience 2020Quote: ... Quantitative PCR (qPCR) was carried out using the cDNA generated previously employing the SensiFAST SYBR mix No-Rox Kit (Bioline, UK in a Rotor-Gene 6000 real-time PCR cycler (Corbett Research ...
-
bioRxiv - Microbiology 2021Quote: Real-time qRT-PCR (quantitative reverse transcription PCR) was used to quantify transcript levels using the SensiFast SYBR Hi-ROX One-Step Kit (Bioline) according to the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2020Quote: ... Real-time PCR reactions were performed in 12 μL mixtures containing 1 x SensiFAST SYBR No-ROX mix (Bioline, Australia), 400 nM of each forward and reverse primer (Table 3 ...
-
bioRxiv - Microbiology 2020Quote: ... Detection and quantification of viruses was conducted by qRT-PCR using the SensiFAST probe no-ROX one step kit (Bioline). The assay for detection of PVM uses primers and probe targeting the SH gene (Forward primer ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA was then used to generate the probe template by standard PCR using the MyTaq™ HSRED DNA Polymerase (Bioline) and opsin specific primers (listed in Table S2 ...
-
bioRxiv - Genetics 2019Quote: ... Ear punches taken to identify animals during routine colony maintenance were placed directly into Buffer A from the MyTaq Extract-PCR kit (Bioline).
-
bioRxiv - Genetics 2021Quote: ... cCREs and promoters were amplified from mouse genomic DNA (extracted fromE14TG2a mESCs, ATCC CRL-1821) by PCR using My-Taq Red mix (#BIO-25044; Bioline) in 384 well plates using automated liquid handling (Hamilton Microlab® STAR) ...
-
bioRxiv - Genomics 2022Quote: ... Presence of the subfamilies in the genomes of additional strains (Table 1) was tested by PCR using the MyTaq polymerase (Bioline) and the primers listed in Sup ...
-
bioRxiv - Molecular Biology 2022Quote: ... and insertions were validated as empty/filled and/or by 5’ and 3’ junction PCRs using MyTaq HS DNA polymerase (Bioline). Validation products were run on 1% agarose gels ...
-
bioRxiv - Biochemistry 2022Quote: ... First-strand cDNA synthesis and subsequent real-time PCR was performed using SensiFast ™ SYBR No-Rox One-Step Kit (Cat.No. BIO- 72005 (Bioline)) ...
-
bioRxiv - Cell Biology 2022Quote: ... The resulting cDNA was subjected to real-time PCR in a Rotorgene 6000 (Corbett Life Science, New South Wales, Australia) using Immomix (2× dilution; Bioline), SYBR Green I (10,000× dilution ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR amplification was performed in a total reaction mixture of 10 μL containing 1x SensiFast master mix (Bioline, Meridian Bioscience), 0.5 μM of reverse and forward primers ...
-
bioRxiv - Microbiology 2022Quote: ... IS2404 real-time PCR mixtures contained of 10.0□μl of 2x SensiFast Probe NO-ROX mix (BioLine Cat# BIO-86005), 3.2□μl of nuclease-free water ...
-
bioRxiv - Molecular Biology 2022Quote: MtDNA copy number was quantified by quantitative PCR (qPCR) using the SensiFAST™ SYBR No-ROX Kit (BIO-98020, Bioline), by amplification of three mtDNA fragments (12S-rRNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... and cDNA was synthesised using SensiFAST cDNA synthesis kit before amplification against transcripts by qRT-PCR kit with SYBR green (Bioline). Alternatively ...
-
bioRxiv - Microbiology 2023Quote: PCR products for the generation of different potential RNase E targets were amplified with MyTaq™ Red Mix 2x (Bioline), and Synechocystis genomic DNA as template (primers T01 to T12) ...
-
bioRxiv - Microbiology 2023Quote: ... A fragment of each gene was individually amplified by polymerase chain reaction (PCR) from the leaf DNA extracts using the MyTaq reaction buffer and polymerase (Bioline) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... and used as a template for quantitative polymerase chain reaction with reverse transcription (qRT–PCR) analysis using SensiFAST SYBR Lo-ROX Kit (Bioline). Samples were analyzed using a QuantStudio 3 Real-Time PCR System (ThermoFisher) ...
-
bioRxiv - Microbiology 2023Quote: ... Quantitative reverse-transcription PCR (qRT-PCR) with was performed with three technical replicates using 50 ng cDNA and the SensiFAST SYBR & Fluorescein Kit (Bioline) on a Roche Lightcycler 96 instrument ...
-
bioRxiv - Cell Biology 2022Quote: ... The qRT-PCR reaction was performed using 35 µL SensiFAST™ Probe Lo- ROX One-Step Kit (Bioline, Taunton, MA) and 15 µL of extracted eluate ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... 20 µl of the epPCR served as a template for a second 1 ml standard PCR with 25 cycles using BioTaq polymerase (Bioline) and primers CW1&2 as previously described49 ...
-
bioRxiv - Plant Biology 2023Quote: ... and the 200 to 400 bp range was purified by gel extraction using Isolate II PCR and Gel Kit (Bioline). Libraries were sequenced (100 bp paired-end ...
-
bioRxiv - Microbiology 2023Quote: ... Indexing PCRs were created by combining 10 μL of purified DNA with 10 μL 2x MyTaq HS Mix polymerase (Bioline) and 1 μl (5 μM ...
-
bioRxiv - Molecular Biology 2024Quote: ... After selection on LB-agar kanamycin plates the resulting colonies were first screened by colony PCR using MyTaq DNA polymerase (Bioline) to check for the presence of the right size insert using T7forward and T7reverese primers ...
-
bioRxiv - Microbiology 2024Quote: ... Single colonies were tested (n = 24-48) for the loss of the vector (erythromycin susceptibility) and by discriminatory PCR (MyTaq HS - Bioline) with specific oligonucleotides to select mutant over WT genotypes ...
-
bioRxiv - Developmental Biology 2021Quote: ... For methylated DNA amplification by PCR each one of these products was mixed with 118 μl of DamID PCR buffer and 2 μl (10 units) of MyTaq™ DNA polymerase (Bioline) and were aliquoted at 40 μl in 4 different 0.2 ml PCR tubes ...