Labshake search
Citations for Bioline :
201 - 250 of 480 citations for rno mir 194 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... qRT-PCR analysis was performed using SensiFast SYBR (BioLine) and gene-specific primers (Supplementary Table 3 ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR was conducted using BIOTAQ DNA polymerase (Bioline, USA). PCR conditions consisted of an initial denaturation step at 94°C for 1 min and 30 cycles of amplification ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR was performed with 2x MyTaq HS Mix (Bioline), using the following Hnrnpu primers ...
-
bioRxiv - Plant Biology 2022Quote: ... Converted DNA was PCR-amplified by MyTaq polymerase (Bioline) for 12 cycles ...
-
bioRxiv - Zoology 2019Quote: ... PCRs included 0.5 U MyTaq HS Mix polymerase (Bioline), 1 μL of DNA template ...
-
bioRxiv - Molecular Biology 2020Quote: ... and amplified via PCR using MyTaq DNA polymerase (Bioline).
-
bioRxiv - Cell Biology 2019Quote: ... qRT-PCR was performed using SensiMix SYBR Green (Bioline) on a QIAGEN Rotor-Gene Q ...
-
bioRxiv - Genetics 2022Quote: PCRs were performed using MyTaq HS DNA Polymerase (Bioline). Reaction mixes contained 5 μl 5x MyTaq Reaction Buffer ...
-
bioRxiv - Plant Biology 2022Quote: ... was carried out using a BioScript PCR kit (Bioline) according to the manufacturer’s instructions in a BioRAD CFX 384 Thermal Cycler (BioRAD ...
-
bioRxiv - Genomics 2022Quote: ... and amplified via PCR using MyTaq DNA polymerase (Bioline). Following amplification ...
-
bioRxiv - Plant Biology 2022Quote: ... Converted DNA was PCR-amplified by MyTaq polymerase (Bioline) for 12 cycles ...
-
bioRxiv - Genetics 2023Quote: PCR validations were performed using MyTaq DNA polymerase (Bioline), including 20 pmol of each primer (Additional file 6) ...
-
bioRxiv - Microbiology 2023Quote: ... qRT-PCR analysis was performed using SensiFast SYBR (BioLine) and gene-specific primers (nLuc FWD 5’ CAGCCGGCTACAACCTGGAC 3’ ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR was performed using MyTaq HS Red Mix (Bioline) with 66°C annealing and 15s elongation ...
-
bioRxiv - Genomics 2023Quote: ... Bisulfite PCR reactions used MyTaq HS DNA polymerase (Bioline), and contained 1× reaction buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... Enrichment of ChIP DNA at predicted sites for each chromatin modification was confirmed by qPCR using primers given in the Key Resources Table and SensiMix SYBR (Bioline, UK). 25 – 100 ng of ChIP DNA was used for library prep using the NEBNext Ultra II DNA Library Prep Kit with NEBNext Single indices (E7645).
-
bioRxiv - Developmental Biology 2021Quote: ... and 7μl of reaction mix containing primers (forward and reverse) at a final concentration of 300nM and Sensifast SYBR®Low-ROX Mix (Bioline). qPCR assays were performed on a Mic qPCR instrument (Bio Molecular Systems ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was then synthesized from 2.5 μg RNA in a 20 μL reaction using both random hexamers and oligo(dT) primers provided with the Tetro cDNA Synthesis kit (Bioline™). Ten defense genes were quantified using the SYBR Green qRT-PCR kit on a ViiA™ 7 sequence detection system ...
-
bioRxiv - Cell Biology 2019Quote: ... The amount of M and NA segment was determined with one-step RT-qPCR using SensiFAST™ Probe Lo-ROX One-Step Kit (Bioline). The sequences of primers and probe for M segment detection are AGA TGA GYC TTC TAA CCG AGG TCG (forward primer) ...
-
bioRxiv - Cell Biology 2020Quote: ... RT-qPCRs were carried out using the SensiFAST SYBR No-ROX kit according to the manufacturer’s instructions (Bioline, London, United Kingdom) on a CFX96™ real-time instrument (Bio-Rad) ...
-
bioRxiv - Microbiology 2020Quote: ... we used a primer concentration of 500 nM in a final volume of 10 μl with the SensiFast SYBR No-ROX Kit (Bioline, London, UK). The amplification conditions were as follows ...
-
bioRxiv - Plant Biology 2022Quote: ... and amplified with primers CUE8cDNA-F (CACCATGGCTAACGAAGAACTCAC) and CUE8cDNA-STOP-R (AGAGACTCAAGACACAGCAGGA) using BIO-X-ACT Long DNA polymerase (Bioline, London, UK). The 2622 bp product was directionally cloned by ligation into the pENTR/D-TOPO vector (Invitrogen/Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... The PCR product was cut from gel to remove any other undesired products and cleaned with the PCR Isolate II PCR and Gel Kit (Bioline, cat. no. BIO-52060). The isolated samples were sequenced by Illumina MiSeq for screen 1 (14.3 million reads ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNA was quantified using SYBR Green PCR master mix (Bioline) and normalized to Hypoxanthine-guanine phosphoribosyltransferase (Hprt ...
-
bioRxiv - Neuroscience 2020Quote: PCR products were generated with BIOMIX red (BIOLINE, London, UK) and 1 μl of the respective restriction enzyme was added directly to the final PCR product for RFLP analysis ...
-
bioRxiv - Plant Biology 2021Quote: ... 35 rounds of PCR were performed using Mango Taq (Bioline) under standard conditions ...
-
bioRxiv - Microbiology 2020Quote: ... Products were purified (Isolate II PCR and Gel kit, Bioline) and Sanger sequenced (Australian Genome Research Facility ...
-
bioRxiv - Neuroscience 2022Quote: ... and quantitative PCR with the library quantification kit from Bioline Jet Set Library Quantification Kit LoROX (Meridian Bioscience ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR was performed with MyTaq DNA or Myfi Polymerases (Bioline) and primers were designed (Suppl ...
-
bioRxiv - Developmental Biology 2022Quote: ... The DNA was PCR amplified using the MyTaq polymerase (Bioline). DNA was sonicated to an average size of 300bp and adaptors were removed by AlwI (NEB ...
-
bioRxiv - Cancer Biology 2019Quote: ... Amplicon PCR reaction was performed using 2x Accuzyme mix (Bioline) and 20 ng of DNA to amplify the barcode using the previously published primers sequences (Bhang et al. ...
-
bioRxiv - Microbiology 2021Quote: ... DNA fragments were amplified by PCR (Accuzyme DNA Polymerase, Bioline, or Supreme NZYProof DNA Polymerase ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR was carried out using Velocity proofreading DNA polymerase (Bioline) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... Every clone was genotyped by PCR (MangoTaq, Bioline, Cat.N. 25033) (primers listed in Supp ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed with Sensimix SYBR Green no-ROX (Bioline) on a Corbett Rotor-Gene 6000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... purified using ISOLATE II PCR and Gel Kit (Bioline, Australia) and Sanger sequenced at the Australian Genome Resource Facility (AGRF) ...
-
bioRxiv - Plant Biology 2023Quote: ... Real-time PCR was performed using SYBR green supermix (Bioline) as per the manufacturer’s instructions on a CFX384 Touch real-time PCR detection system ...
-
bioRxiv - Physiology 2022Quote: ... Each PCR reaction contained 10µl of MyTaqRed Mix (Bioline, C755G95), 350nM of each primer ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative PCR was performed using SensiFAST™ SYBR kit (BIOLINE). The primer sequences used for qPCR are listed in Table S1 ...
-
bioRxiv - Microbiology 2023Quote: ... Quantitative PCR was performed according to the manufacturer’s instructions (Bioline). Briefly ...
-
bioRxiv - Cell Biology 2024Quote: ... Genotyping PCRs were performed with MyTaq HS Red Mix (Bioline), using primers surrounding the genomic target sites ...
-
bioRxiv - Immunology 2022Quote: ... Gene expression analysis was performed by quantitative real time PCR (qRT-PCR) with SensiFAST™ SYBR® Lo-ROX Kit (Bioline Reagents Ltd., London, UK) run on the QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Immunology 2021Quote: ... Gene expression analysis was performed by quantitative real time PCR (qRT-PCR) with SensiFAST™ SYBR® Lo-ROX Kit (Bioline Reagents Ltd., London, UK) run on the QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... Cas9 target sites within the AAVS1 locus were PCR amplified in a 25 or 50 μL reaction volume per sample using high-performance RANGER PCR Mix (Bioline USA, Inc., Memphis, TN, USA) or PlatinumTM SuperFiTM PCR Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... The DamID PCR buffer consisted of 1.36x MyTaq™ Buffer (Bioline) and 1.06 μM of the DamID PCR primer (Adr_PCR ...
-
bioRxiv - Genetics 2021Quote: ... target genomic regions were amplified by PCR with BioMix Red (Bioline), sent for Sanger sequencing by MCLAB (South San Francisco ...
-
bioRxiv - Bioengineering 2020Quote: ... The PCR was performed with 20 µL Mango Mix™ (Bioline), 0.25 µM of each primer and 2 µL of DNA template in a final volume of 40 µL ...
-
bioRxiv - Genetics 2019Quote: ... PCR amplification was performed with MyTaq DNA Polymerase (Bioline BIO-21108) and purified with Qiagen QIAquick PCR Purification kit (Qiagen 28104) ...
-
CASC3 promotes transcriptome-wide activation of nonsense-mediated decay by the exon junction complexbioRxiv - Molecular Biology 2020Quote: ... Semi-quantitative PCR was carried out with MyTaq Red Mix (Bioline). Quantitative real time PCR was performed with 16 ng of cDNA per reaction with GoTaq qPCR Master Mix (Promega ...
-
bioRxiv - Microbiology 2019Quote: ... containing 50 μl of 2x PCR BioMix™ (Bioline, London, UK), 1 ul (5 pmol ...