Labshake search
Citations for Bioline :
251 - 300 of 951 citations for hsa mir 296 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... qRT-PCR was carried out with specific primer sets (listed in Supplementary Table 10) using SensiFAST™ SYBR® No-ROX Kit (BIOLINE, BIO-98005) and CFX Connect Real-Time PCR Detection System (BIO-RAD ...
-
bioRxiv - Physiology 2020Quote: ... using SYBR Green PCR master mix (Bioline). Data is represented as 2^-ΔCt compared to average of PC1/3 in healthy group ...
-
bioRxiv - Synthetic Biology 2020Quote: ... PCR reactions were conducted using MyTaq (Bioline) DNA polymerase ...
-
Psi promotes Drosophila wing growth through transcriptional repression of key developmental networksbioRxiv - Developmental Biology 2020Quote: ... PCR using MyTaq polymerase (Bioline BIO-21113) was performed with 3 long extension cycles followed by 17 short extension cycles as described (Vogel ...
-
bioRxiv - Neuroscience 2019Quote: A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were generated in 25 µl reactions containing 12.5 µl Bioline PCR Master Mix (Bioline USA Inc, Taunton, MA), 10.0 µl MG H2O ...
-
bioRxiv - Developmental Biology 2019Quote: ... PCR reactions were resolved in 1 % agarose (Bioline) gels containing 0.5 μg/ml Ethidium Bromide (Sigma ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCRs were conducted using SensiFast (Bioline, London, UK) on the CFX384 RT-PCR detection system (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2024Quote: ... utilizing SensiFast Lo-ROX qRT-PCR Mastermix (Bioline) in both biological and technical triplicate ...
-
bioRxiv - Developmental Biology 2022Quote: ... qPCR reactions were carried out using 1.25 ng total RNA equivalent RT reaction in sensiFAST SYBR No-Rox mix (Bioline) in presence of 600 nM of each primer ...
-
bioRxiv - Microbiology 2021Quote: ... For the PCR master mix (MM) MangoTaq DNA polymerase and MyTaq DNA Polymerase were used and all PCR reagents were from Bioline (London, UK). To reduce the PCR inhibitors 0.4 μg μL−1 of bovine serum albumin (BSA ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR was performed with BIOTAQ DNA Polymerase (Bioline, UK) using the following program ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR of cDNA was performed using MyFi Taq (Bioline) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... qRT-PCR analysis was performed using SensiFast SYBR (BioLine) and gene-specific primers (Supplementary Table 3 ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR was conducted using BIOTAQ DNA polymerase (Bioline, USA). PCR conditions consisted of an initial denaturation step at 94°C for 1 min and 30 cycles of amplification ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR was performed with 2x MyTaq HS Mix (Bioline), using the following Hnrnpu primers ...
-
bioRxiv - Plant Biology 2022Quote: ... Converted DNA was PCR-amplified by MyTaq polymerase (Bioline) for 12 cycles ...
-
bioRxiv - Zoology 2019Quote: ... PCRs included 0.5 U MyTaq HS Mix polymerase (Bioline), 1 μL of DNA template ...
-
bioRxiv - Molecular Biology 2020Quote: ... and amplified via PCR using MyTaq DNA polymerase (Bioline).
-
bioRxiv - Cell Biology 2019Quote: ... qRT-PCR was performed using SensiMix SYBR Green (Bioline) on a QIAGEN Rotor-Gene Q ...
-
bioRxiv - Genetics 2022Quote: PCRs were performed using MyTaq HS DNA Polymerase (Bioline). Reaction mixes contained 5 μl 5x MyTaq Reaction Buffer ...
-
bioRxiv - Genomics 2022Quote: ... and amplified via PCR using MyTaq DNA polymerase (Bioline). Following amplification ...
-
bioRxiv - Plant Biology 2022Quote: ... Converted DNA was PCR-amplified by MyTaq polymerase (Bioline) for 12 cycles ...
-
bioRxiv - Genetics 2023Quote: PCR validations were performed using MyTaq DNA polymerase (Bioline), including 20 pmol of each primer (Additional file 6) ...
-
bioRxiv - Microbiology 2023Quote: ... qRT-PCR analysis was performed using SensiFast SYBR (BioLine) and gene-specific primers (nLuc FWD 5’ CAGCCGGCTACAACCTGGAC 3’ ...
-
bioRxiv - Genomics 2023Quote: ... Bisulfite PCR reactions used MyTaq HS DNA polymerase (Bioline), and contained 1× reaction buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR was performed using MyTaq HS Red Mix (Bioline) with 66°C annealing and 15s elongation ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNA was quantified using SYBR Green PCR master mix (Bioline) and normalized to Hypoxanthine-guanine phosphoribosyltransferase (Hprt ...
-
bioRxiv - Neuroscience 2020Quote: PCR products were generated with BIOMIX red (BIOLINE, London, UK) and 1 μl of the respective restriction enzyme was added directly to the final PCR product for RFLP analysis ...
-
bioRxiv - Plant Biology 2021Quote: ... 35 rounds of PCR were performed using Mango Taq (Bioline) under standard conditions ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR was performed with MyTaq DNA or Myfi Polymerases (Bioline) and primers were designed (Suppl ...
-
bioRxiv - Developmental Biology 2022Quote: ... The DNA was PCR amplified using the MyTaq polymerase (Bioline). DNA was sonicated to an average size of 300bp and adaptors were removed by AlwI (NEB ...
-
bioRxiv - Cancer Biology 2019Quote: ... Amplicon PCR reaction was performed using 2x Accuzyme mix (Bioline) and 20 ng of DNA to amplify the barcode using the previously published primers sequences (Bhang et al. ...
-
bioRxiv - Microbiology 2021Quote: ... DNA fragments were amplified by PCR (Accuzyme DNA Polymerase, Bioline, or Supreme NZYProof DNA Polymerase ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR was carried out using Velocity proofreading DNA polymerase (Bioline) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... Every clone was genotyped by PCR (MangoTaq, Bioline, Cat.N. 25033) (primers listed in Supp ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed with Sensimix SYBR Green no-ROX (Bioline) on a Corbett Rotor-Gene 6000 ...
-
bioRxiv - Physiology 2022Quote: ... Each PCR reaction contained 10µl of MyTaqRed Mix (Bioline, C755G95), 350nM of each primer ...
-
bioRxiv - Microbiology 2023Quote: ... Quantitative PCR was performed according to the manufacturer’s instructions (Bioline). Briefly ...
-
bioRxiv - Cell Biology 2024Quote: ... Genotyping PCRs were performed with MyTaq HS Red Mix (Bioline), using primers surrounding the genomic target sites ...
-
bioRxiv - Cell Biology 2023Quote: ... Cas9 target sites within the AAVS1 locus were PCR amplified in a 25 or 50 μL reaction volume per sample using high-performance RANGER PCR Mix (Bioline USA, Inc., Memphis, TN, USA) or PlatinumTM SuperFiTM PCR Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... The DamID PCR buffer consisted of 1.36x MyTaq™ Buffer (Bioline) and 1.06 μM of the DamID PCR primer (Adr_PCR ...
-
bioRxiv - Genetics 2021Quote: ... target genomic regions were amplified by PCR with BioMix Red (Bioline), sent for Sanger sequencing by MCLAB (South San Francisco ...
-
bioRxiv - Bioengineering 2020Quote: ... The PCR was performed with 20 µL Mango Mix™ (Bioline), 0.25 µM of each primer and 2 µL of DNA template in a final volume of 40 µL ...
-
bioRxiv - Genetics 2019Quote: ... PCR amplification was performed with MyTaq DNA Polymerase (Bioline BIO-21108) and purified with Qiagen QIAquick PCR Purification kit (Qiagen 28104) ...
-
CASC3 promotes transcriptome-wide activation of nonsense-mediated decay by the exon junction complexbioRxiv - Molecular Biology 2020Quote: ... Semi-quantitative PCR was carried out with MyTaq Red Mix (Bioline). Quantitative real time PCR was performed with 16 ng of cDNA per reaction with GoTaq qPCR Master Mix (Promega ...
-
bioRxiv - Microbiology 2019Quote: ... containing 50 μl of 2x PCR BioMix™ (Bioline, London, UK), 1 ul (5 pmol ...
-
bioRxiv - Microbiology 2019Quote: ... containing 50 μl of 2x PCR BioMix™ (Bioline, London, UK), 5 pmol of both forward and reverse primers ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... With a standard qualitative PCR (0.125 My Taq™ polymerase (Bioline), 5μl 5x buffer ...
-
bioRxiv - Immunology 2021Quote: ... The PCR reactions were assembled using 45 μL master mix (Bioline) containing 2x buffer ...