Labshake search
Citations for Bioline :
1 - 50 of 118 citations for Recombinant Human Chemokine C X C Motif Ligand 10 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... cDNA synthesis was performed with 0.25-1 µg of RNA in a 20 µL total reaction volume using a random hexamer/oligo dT strand synthesis kit as per the manufacturer’s instructions (10 min at 25°C; 15 min at 42°C; 15 min at 48°C; SensiFast, Bioline). All oligonucleotide sequences are listed in Table 1.
-
bioRxiv - Microbiology 2020Quote: ... and cDNA synthesized with 0.25-1μg of RNA in a 20μL total reaction volume using a random hexamer/oligo dT strand synthesis kit in accordance with the manufacturer’s instructions (10 minutes at 25°C; 15 minutes at 42°C; 15 minutes at 48°C; SensiFast, Bioline). PCR amplification of HBV RNAs were performed using primers as previously described43 using a SYBR green real-time PCR protocol (qPCRBIO SyGreen ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2.5μl of 10 x Buffer (Bioline), 1.25μl of 50mM MgCl2 (Bioline) ...
-
bioRxiv - Pathology 2024Quote: ... then incubated overnight at 37°C with staining buffer (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside [X-gal, Bioline, London ...
-
bioRxiv - Genomics 2023Quote: ... 1’ 72°C) by MyTaq Red mix (Bioline) using primers that add overhangs with EcoRI (MT024 ...
-
bioRxiv - Genomics 2020Quote: ... at 37°C for 30 min and then proteinase K digestion (Bioline, cat. #37084) for 2 h at 56 °C ...
-
bioRxiv - Genomics 2023Quote: ... for 1 hour at 37°C and proteinase K (40 ug, Bioline BIO-37084) for 2 hours at 55°C ...
-
bioRxiv - Genomics 2019Quote: ... pool C was diluted 1,000-fold and 1.5 fmol were amplified using VELOCITY DNA polymerase (Bioline) with forward primer pool-FP1 and reverse primer pool-RP2 using the following PCR conditions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Quantitative RT-PCR was performed using SensiMix SYBR Low-ROX Kit (Bioline; annealing temperature – 60°C) in a Lightcycler 480 384-well plate (Roche) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cross-linking was reversed by overnight incubation at 60°C with proteinase K (Bioline, Lot # BIO-37037). Then 3C libraries were purified by phenol-chloroform followed by chloroform extraction and ethanol-precipitated at −80°C overnight ...
-
bioRxiv - Microbiology 2019Quote: ... for 14 hours at 37 °C in the presence of RiboSafe RNAse Inhibitor (Bioline, cat. number BIO-65028). Next ...
-
bioRxiv - Genetics 2021Quote: ... and then digested with proteinase K (20 μg per sample at 56°C for 2 h; Bioline, cat. # 37084), and electrophoresed on a 1.5% agarose gel to verify that the majority of fragments were 100-400 bp in size ...
-
bioRxiv - Neuroscience 2022Quote: ... Dehydrated samples were rehydrated through a series of methanol/PBS washes for 10 minutes each at room temperature with an additional 3 x 10 minutes PBSTw (0.1% Tween-20) and treated with proteinase K (1:1000, Bioline) for 20 minutes to increase permeabilization ...
-
bioRxiv - Genetics 2019Quote: ... cDNA was diluted in nuclease-free water and stored at −20°C until used in qPCR with the SensiFastTM SYBR® No-ROX kit (Bioline) and a Lightcycler® 480/1536 (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... Tissue pieces were digested at 4 °C on an orbital shaker-incubator at 200 × rpm (Bioline Global, New South Wales, Australia). After overnight digestion ...
-
bioRxiv - Microbiology 2020Quote: Bacterial cultures were grown in Luria Bertani (LB) broth for 18-24h at 37 °C and DNA was extracted using the Isolate II Genomic DNA Kit (Bioline, UK) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1.2 x Hifi Buffer (Bioline), 0.1 x SYBR Green (Sigma) ...
-
bioRxiv - Cell Biology 2019Quote: ... The hPL-PIPC units were distributed into 45 mL aliquots and stored at −20°C in a freezer (Gram BioLine, Vojens, Denmark). In addition ...
-
bioRxiv - Molecular Biology 2020Quote: ... Recombinant proteins were produced in Escherichia coli BL21 (DE3) cells (Bioline) as described previously (LaCourse ...
-
bioRxiv - Physiology 2021Quote: ... was performed with three primers (Figure 1 A, “a”: AAGGCGCATAACGATACCAC, “b”: TACAATGCAGGCTCCAAACAC, “c”: CGAGCACAGGAAGTTCAACA, Eurofins Genomics, Ebersberg/Germany) and the ImmoMix™ kit (Bioline, Cat. No BIO-25020) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2020Quote: ... Human genomic DNA purchased from Bioline Australia (Cat No ...
-
bioRxiv - Microbiology 2020Quote: ... 1 ng human genomic DNA (Bioline, Cat. # BIO-35025) was used as negative control ...
-
bioRxiv - Microbiology 2019Quote: PCR for cloning purposes was performed using the proofreading Bio-X-ACT (Bioline) enzyme ...
-
bioRxiv - Zoology 2022Quote: ... 0.5 μl BIO-X-ACT short DNA polymerase (Bioline Reagents Ltd, London, UK), 35.4 μl ddH2O ...
-
bioRxiv - Microbiology 2023Quote: PCR for cloning purposes was performed using the proofreading Bio-X-ACT (Bioline) or Phusion (NEB ...
-
bioRxiv - Genomics 2023Quote: ... 25 μL 2 x MyTaq HS Red Mix (Bioline, cat. no. BIO-25048), and plate-specific Illumina PCR indexed primers (TAC0012 and TAC0007 ...
-
bioRxiv - Genomics 2023Quote: ... PCR2 was performed using 15 μL 2 x MyTaq Red Mix (Bioline, cat. no. BIO-25044) and 5 μL of each PCR1 product with well-specific Illumina PCR indexed primers (TAC0159 & TAC0009 ...
-
bioRxiv - Plant Biology 2022Quote: ... 10 μl 2X BioMix Red (Bioline) and ddH2O ...
-
bioRxiv - Molecular Biology 2020Quote: ... including 10 μl of 10 mg/ml BSA solution and 5 μl of HyperLadder 1 kb (BIOLINE), 200 μl of the filtered cell lysates was injected onto the pre-equilibrated SEC column ...
-
bioRxiv - Neuroscience 2023Quote: Human samples: qPCR experiments were conducted using the SensiFAST Probe Hi-ROX Master Mix (Bioline) and the TaqMan Gene Expression Assays (Applied Biosystems ...
-
bioRxiv - Neuroscience 2022Quote: ... Agarose gels (1.5%) were prepared in 1 X TAE buffer (Astral Scientific) with 0.01% SYBR Safe DNA gel stain (Bioline). PCR products (5 µL ...
-
bioRxiv - Microbiology 2019Quote: ... 1 µl of 10 mM dNTP’s (BioLine), and 0.25 µl iProof (BioRad) ...
-
bioRxiv - Microbiology 2022Quote: ... Quantification of SFB in human tissue biopsies was performed using the MasterMix SensiFAST™ SYBR (BIOLINE) and 3 different primer sets ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Reactions were performed in a total volume of 25 μl containing 12.5 μl 2 x MyTaq Red (Bioline, UK), 0.5 μl of each 10 μM primer stock ...
-
bioRxiv - Developmental Biology 2019Quote: ... 0.4 μM zebrafish genotyping primers (Extended Data Fig.5A, Table 2) and 1 x MyTaq Red DNA Polymerase (Bioline) according to the manufacturer’s protocol in a T100 thermal cycler ...
-
bioRxiv - Molecular Biology 2019Quote: ... 15 pmol of each forward primer 341F 5’-NNNNNNNNNNTCCTACGGGNGGCWGCAG and reverse primer 785R 5’-NNNNNNNNNNTGACTACHVGGGTATCTAAKCC in 20 μL volume of 1 x MyTaq buffer containing 1.5 units MyTaq DNA polymerase (Bioline) and 2 μl of BioStabII PCR Enhancer (Sigma) ...
-
bioRxiv - Plant Biology 2019Quote: ... 0.4 μL 10 μM specific primer pairs (mixture of forward and reverse primers) was mixed with 10 μL SensiFAST SYBR (Bioline) mastermix and 9.6 μL of cDNA ...
-
bioRxiv - Microbiology 2023Quote: ... Indexing PCRs were created by combining 10 μL of purified DNA with 10 μL 2x MyTaq HS Mix polymerase (Bioline) and 1 μl (5 μM ...
-
bioRxiv - Microbiology 2023Quote: ... both samples were subjected to PCR with human GAPDH-specific primers41 and MyTaq polymerase (Bioline, Taunton, MA). Resulting PCR amplicons were visualized by agarose gel electrophoresis ...
-
bioRxiv - Microbiology 2020Quote: ... Real-time PCR reactions were performed in 12 μL mixtures containing 1 x SensiFAST SYBR No-ROX mix (Bioline, Australia), 400 nM of each forward and reverse primer (Table 3 ...
-
bioRxiv - Cell Biology 2022Quote: ... and RNase inhibitor (10 U per reaction, Bioline). The resulting cDNA was subjected to real-time PCR in a Rotorgene 6000 (Corbett Life Science ...
-
bioRxiv - Microbiology 2019Quote: Plasmodium screening of human subjects was done in the regions surrounding Mbita using RDT kits (SD Bioline, UK). Microscopy was carried out on RDT-positive samples to confirm the presence of P ...
-
bioRxiv - Developmental Biology 2022Quote: ... 10 μL of SensiFAST SYBR No-ROX Mix (Bioline), and 1 μL of cDNA template ...
-
bioRxiv - Microbiology 2023Quote: ... 10 µl MyTaq™ Red Mix (Bioline, Meridian bioscience) was used with 2 µl 20 µM primer mix ...
-
Disruption of the Aspergillus fumigatus RNA interference machinery alters the conidial transcriptomebioRxiv - Microbiology 2023Quote: ... and 10 μl of 2x MyTaq HS Mix (Bioline). Specific primers (qRT_coxV_for / qRT_coxV_rev ...
-
bioRxiv - Cell Biology 2021Quote: ... The interaction between the protein products fused to the DNA binding and activation domains were analyzed by the activity of β-galactosidase by the cleavage of X-Gal (BIO-37035, Bioline, UK). For detecting the β-galactosidase activity overlaying of low melting agarose with X-Gal (over lay mix was prepared freshly) ...
-
bioRxiv - Plant Biology 2022Quote: ... and amplified with primers CUE8cDNA-F (CACCATGGCTAACGAAGAACTCAC) and CUE8cDNA-STOP-R (AGAGACTCAAGACACAGCAGGA) using BIO-X-ACT Long DNA polymerase (Bioline, London, UK). The 2622 bp product was directionally cloned by ligation into the pENTR/D-TOPO vector (Invitrogen/Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... PCR amplification of each gene was performed in a 25-µL reaction mix using the Bio-X-Act short polymerase mix (Bioline, London, UK), 0.2 μM of forward and reverse primers ...
-
bioRxiv - Molecular Biology 2024Quote: ... the Methyl Indexed PCR was performed by mixing 4 µL of ligated DNA with x-Gen Dual combinatorial Indexes (IDT) (125 nM final concentration) and MyTaq RedMix (Bioline, BIO-25048) in a final volume of 40 µL ...
-
bioRxiv - Immunology 2022Quote: ... using either BIOLASETM polymerase (7×10-5 approximate error/bp) or MyFiTM polymerase (7×10-5 approximate error/bp) both from Bioline (Meridian Bioscience, USA). The PCR mixture consisted of 1X buffer with 1mM dNTP ...