Labshake search
Citations for Bioline :
1 - 50 of 91 citations for Recombinant Human CEACAM1 Protein His Avi tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... Recombinant proteins were produced in Escherichia coli BL21 (DE3) cells (Bioline) as described previously (LaCourse ...
-
bioRxiv - Neuroscience 2023Quote: Human samples: qPCR experiments were conducted using the SensiFAST Probe Hi-ROX Master Mix (Bioline) and the TaqMan Gene Expression Assays (Applied Biosystems ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Sensifast Hi-Rox SyBr kit (Bioline) was used to perform the RT-qPCR on a StepOnePlus system (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... using SensiFAST SYBR Hi-ROX (Bioline). A total cDNA concentration of 100 ng in combination with 200 nM of dapE oligonucleotide per reaction (Supplementary Table 5 ...
-
bioRxiv - Developmental Biology 2019Quote: ... with SensiMix SYBR Hi-ROX Kit (Bioline) following manufactures instructions ...
-
bioRxiv - Microbiology 2020Quote: ... The SensiFAST SYBR Hi-ROX kit (Bioline) was used for qPCR reactions ...
-
bioRxiv - Microbiology 2021Quote: ... or SensiFAST SYBR Hi-ROX kit (Bioline). Reactions were run using Applied Biosystems 7500 fast RT-PCR machine (Thermofisher ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the SensiMix SYBR Hi-ROX (Bioline Reagents) was used ...
-
bioRxiv - Molecular Biology 2021Quote: ... and SensiFAST SYBR Hi-ROX mix (Bioline). Total reaction volume was 10 µl with 150 nM of each primer ...
-
bioRxiv - Genetics 2020Quote: ... CpGs 4-8 (F– TTTAGTAGAGGAAATAAAATAGTAGAAAAA-Biotinylated; R: CCCCAAAAAACCACAAAACCTA) CpGs 9-11 (F – GGATGGAGGAATTTTTTTGTGTT; R: CCCCAAAAAACCACAAAACCTA -Biotinylated) using MyTaq HS mix PCR reagents (Bioline). Amplicons were processed on the Qiagen Q24 Workstation and sequenced in duplicate on the Qiagen Q24 pyrosequencer using the sequencing primers CpGs 4-8 (AACAATTTAAACAAAAAATAACATT ...
-
bioRxiv - Cell Biology 2021Quote: ... SensiFAST™ SYBR® Hi-ROX Kit (Bioline) in QuantStudio™ 5 (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The SensiFAST SYBR® Hi-ROX kit (Bioline) was used for qRT-PCR that was performed with the QuantStudio 3 Real-Time PCR system (Applied Biosystems ...
-
bioRxiv - Immunology 2023Quote: ... using the SensiFAST SYBR Hi-ROX kit (Bioline). Predesigned KiCqStart SYBR green primers for the analyzed cytokines ...
-
bioRxiv - Immunology 2021Quote: ... and assessed by qPCR (SensiMix SYBR Hi-Rox, Bioline). Expression levels of each gene were normalized against GAPDH expression and fold change was calculated using the 2-ΔCT or 2-ΔΔCT equations [54] ...
-
bioRxiv - Cell Biology 2023Quote: ... assays and SensiFAST™ Probe Hi-ROX Kit (Bioline) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... assays and SensiFAST™ Probe Hi-ROX Kit (Bioline) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR was performed using SensiFast SYBR Hi-ROX kit (Bioline) on CFX96 Touch Real-Time PCR System (Bio-Rad) ...
-
bioRxiv - Microbiology 2019Quote: ... qPCR reactions were performed using SensiFAST SYBR Hi-ROX (Bioline) according to the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2021Quote: ... 125nM) and SensiFAST Probe Hi-ROX One-Step Kit (Bioline) according to the manufacturer’s instructions in a 20μl reaction with 5μl sample ...
-
bioRxiv - Microbiology 2020Quote: ... The Sensi-FAST SYBR Hi-ROX One-Step Kit (Bioline) was used for quantitative real time PCR (qRT-PCR) ...
-
bioRxiv - Microbiology 2021Quote: ... with Sensi-FAST Probe Hi-ROX qPCR kit (Bioline, 82005) (8).
-
bioRxiv - Developmental Biology 2023Quote: ... Reactions were performed with SensiFAST SYBR Hi-ROX kit (Bioline), and all samples and negative controls were run in technical duplicate on an Applied Bioscience StepOnePlus qPCR machine (Life Technologies).
-
bioRxiv - Cell Biology 2021Quote: ... qPCR was performed using SensiFast SYBR Hi-ROX qPCR kit (BioLine). rp49 was used as a housekeeping gene for ΔΔCt calculations ...
-
bioRxiv - Microbiology 2019Quote: ... The SensiFAST SYBR Hi-ROX kit (Bioline United Kingdom, BIO-92020) and custom gene-specific primer sets were used to assay 20 ng DNA per reaction for HCMV gB (UL55 ...
-
bioRxiv - Microbiology 2020Quote: ... in 20μl reactions using the SensiFAST Probe Hi-ROX Kit (Bioline) (cycling conditions ...
-
bioRxiv - Cell Biology 2020Quote: ... qPCR was performed using SensiFAST™ SYBR Hi-ROX Kit (Bioline). rp49 was used as a housekeeping gene for ΔCt calculations ...
-
bioRxiv - Immunology 2019Quote: ... qPCR was then performed using the SensiFAST SYBR Hi-Rox kit (Bioline) and a StepOnePlus real-time PCR instrument (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2019Quote: ... Resulting cDNA was amplified with the SensiFAST Probe Hi-ROX Kit (Bioline). The fold change in expression were calculated by the ΔΔCT method using snoRNA202 and U6 RNA as reference small RNAs in mouse and human cells ...
-
bioRxiv - Cancer Biology 2019Quote: ... Quantitative PCR was performed using the SensiFAST SYBR Hi-ROX kit (Bioline) and an AriaMX Real Time PCR system (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: ... Quantitative PCR was performed with the SensiFAST SYBR Hi-ROX Kit (Bioline) using a StepOnePlus 96-well plate reader (Applied Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: ... in 20μl reactions using the Sensi FAST Probe Hi-ROX Kit (Bioline) (cycling conditions ...
-
bioRxiv - Immunology 2019Quote: ... Quantitative-PCR was set up using the SensiFAST SYBR Hi-ROX kit (Bioline) on a StepONE system (Applied Biosytems) ...
-
bioRxiv - Microbiology 2020Quote: ... 12.5 µL SensiFAST(tm) Probe Hi-ROX Kit master mix (Bioline, Tauton, MA), 1.25 µL each of Cx ...
-
bioRxiv - Microbiology 2019Quote: ... using the SensiMix™ SYBR® Hi-ROX Kit (Bioline, Cat#QT605-05).
-
bioRxiv - Cancer Biology 2020Quote: Gene Expression was quantified using the SensiFAST SYBR Hi-Rox Kit (Bioline, 92090) in combination with the StepOnePlus Real-Time PCR System (Thermo Fisher) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Quantitative RT-PCR reactions were performed with SensiFAST SYBR Hi-ROX kit (Bioline) and gene-specific primers (Supplemental File S2) ...
-
bioRxiv - Microbiology 2023Quote: ... 1.5 µl of sterile water and 7.5 µl SYBR Hi-ROX mix (Bioline). Reaction conditions were as follows ...
-
bioRxiv - Genomics 2024Quote: ... RT-qPCR was conducted using SensiMix SYBR Hi-ROX 2x Master Mix (Bioline) on the Rotor-Gene Q (Qiagen) ...
-
bioRxiv - Microbiology 2022Quote: ... utilizing the SensiMix™ SYBR® Hi-ROX Kit (Bioline, Meridian Bioscience; Cincinnati, OH), as previously described (primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1.6ul reverse primer (5uM) and 10ul SensiFAST SYBR Hi-ROX mix (Bioline, Cat: BIO92020). The plate was then loaded into an Agilent AriaMax real time PCR machine (Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... using the SensiFAST™ Sybr® Hi-ROX Kit (#BIO-92020; Bioline, London, UK). Amplification was performed in a reaction volume of 10 μL containing 500 nM of each of the forward and reverse primers and 4 μL of a two-fold dilution of C ...
-
bioRxiv - Cell Biology 2020Quote: ... subsequently diluted in water (1:4) and mixed with SensiFAST SYBR Hi-Rox (Bioline) and the appropriate primers at a final concentration of 10 μM ...
-
Isonicotinamide extends yeast chronological lifespan through a mechanism that diminishes nucleotidesbioRxiv - Biochemistry 2021Quote: ... and quantitated by real-time PCR reactions using SensiMix SYBR Hi-ROX Mastermix (Bioline) run on a StepOne Plus thermocycler (Applied Biosystems) ...
-
bioRxiv - Genomics 2022Quote: ... Quantification was carried using SensiFAST™ SYBR® Hi-ROX One-Step Kit (Bioline). Absolute RNA quantification was obtained by interpolating its CT value against the standard curve ...
-
bioRxiv - Cancer Biology 2021Quote: ... The RT-qPCR reaction was performed using SensiFAST SYBR Hi-ROX Kit (Bioline #BIO-92020) on the StepOnePlus™ platform (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Real-time PCR was carried out using the SensiFAST SYBR Hi-ROX kit (Bioline, BIO92005). Briefly ...
-
bioRxiv - Immunology 2022Quote: ... Quantitative PCR were performed on 20ng cDNA using and SensiFAST Probe Hi-ROX kits (BioLine) on a Quant Studio III (Applied BioSystem) ...
-
bioRxiv - Microbiology 2020Quote: ... prat2 expression was assessed with the SensiFAST™ SYBR® Hi-ROX One-Step Kit (Bioline) according to manufacturer’s recommendations with specific primers PP25361 (Forward ...
-
bioRxiv - Biochemistry 2020Quote: ... using TaqMan™ Gene Expression Assays (FAM-labelled) and the SensiFASTTM Probe Hi-ROX kit (Bioline). ΔCt was calculated as Ct [Target]-Geometric mean (Ct [HPRT1] ...
-
bioRxiv - Cancer Biology 2019Quote: ... Quantitative-RT PCR was then performed using the SensiFAST SYBR Green Hi-ROX master mix (Bioline). Primers were designed (Sigma Aldrich ...