Labshake search
Citations for Bioline :
51 - 100 of 819 citations for Rat EGF Latrophilin And Seven Transmembrane Domain Containing Protein 1 ELTD1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... For RT-qPCR cDNA was prepared from 1 µg of total RNA using the SensiFAST cDNA Synthesis Kit (BIO-65054, Bioline) and analysed by qPCR using the SensiFast SYBR Lo-ROX Kit (BIO-94050 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... qRT-PCR was carried out on 1:10 diluted cDNA on an Applied Biosystems StepOnePlus system using Sensifast Hi-Rox Sybr kit (Bioline). Cycle conditions were as follows ...
-
bioRxiv - Cell Biology 2021Quote: mRNA was isolated using NucleoSpin® RNA Plus (Machery-Nagel) and 1 µg of total mRNA was reverse-transcribed into cDNA using SensiFASTTM cDNA Synthesis Kit (Bioline) according to the manufacture’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Isolated RNA (0.5-1 µg) was then used for reverse transcription into first strand cDNA via a SensiFast cDNA synthesis kit (Bioline). RNA spike I (TATAA ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... qRT-PCR was carried out on 1:2 diluted cDNA on an Applied Biosystems StepOnePlus system using a Sensifast Hi-Rox SYBR kit (Bioline). Cycle conditions were as follows ...
-
bioRxiv - Molecular Biology 2020Quote: ... Recombinant proteins were produced in Escherichia coli BL21 (DE3) cells (Bioline) as described previously (LaCourse ...
-
bioRxiv - Microbiology 2021Quote: ... Each reaction (20 μL) consisted of 1 μL of cDNA substrate and 19 μL of a SensiFAST No-ROX Kit Master Mix (Bioline, UK). Following primer optimisation ...
-
bioRxiv - Developmental Biology 2020Quote: cDNA was diluted 1:10 in nuclease-free water and subsequently applied for qRT-PCR using the SensiFast™SYBR HiROX Kit (Bioline) according to the manufacturer’s instructions ...
-
bioRxiv - Pathology 2023Quote: ... All real-time PCR reactions were performed in 20 μL volumes containing 10 μL Immomix (Bioline) and 5 μL of DNA template ...
-
bioRxiv - Biochemistry 2022Quote: ... Protein overexpression was performed using Escherichia coli BL21 (DE3) pLysS cells (BIOLINE) in super broth supplemented with 200 μg/mL ampicillin (AMRESCO ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 ng of the total RNA was reverse-transcribed into cDNA using a Tetro cDNA synthesis kit (BIO-65042, Bioline, London, UK). Quantitative PCR (RT-qPCR ...
-
bioRxiv - Neuroscience 2022Quote: ... Multiplex PCR amplification was performed in a 10 μL reaction containing 1X MyTaq HS Red Mix (Bioline), 10 ng DNA template ...
-
bioRxiv - Pathology 2023Quote: ... Reactions for uniplex and duplex assays were performed in 20 μL volumes containing 10 μL Immomix (Bioline) and 5 μL of DNA template ...
-
bioRxiv - Microbiology 2019Quote: ... using the amplification kit SensiFAST SYBR No-Rox kit (Bioline, London, UK), according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... A total of 1 µg of total RNA was used to initiate cDNA synthesis using the SensiFAST™ cDNA Synthesis Kit (Bioline, London, UK). The SYBR Green assay with SensiFAST™ SYBR no ROX kit was used for the quantification of transcripts in RT-PCR ...
-
bioRxiv - Developmental Biology 2019Quote: ... 2.5 ng cDNA was amplified in a 10 μl reaction containing 1x Sensimix Sybr Hi-Rox reagents (Bioline) and 375 nM of both forward and reverse primer (Supplementary Table S1) ...
-
bioRxiv - Developmental Biology 2019Quote: ... 20 ng DNA was used in a 10 μl reaction containing 1x Sensimix Sybr Hi-Rox reagents (Bioline) and 375 nM of both forward and reverse primer (Supplementary Table S1) ...
-
bioRxiv - Genetics 2022Quote: ... the multiplex-PCR was performed in a total volume of 25 μl mix solution containing 12.5μl MyTaq HS Red Mix (Bioline), 40ng of genomic DNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Amplifications were carried-out in total volume of 10 µL containing 1x SensiFast master mix (Bioline, Meridian Bioscience), 0.5 μM of each primer set (dhfr-F/R and 529rpe-F/R) ...
-
bioRxiv - Genetics 2022Quote: ... The Endpoint PCR amplification (gDNA concentration of 20-50 ng μl−1 per sample) for each target region were performed using MyFi™ DNA Polymerase Kit (Bioline GmbH, Luckenwalde, Germany) and specific primers (IDENTXX GmbH)in a PCR thermal cycler (T100 PCR thermal cycler ...
-
bioRxiv - Bioengineering 2022Quote: ... SensiFAST cDNA Synthesis Kit and the SensiFAST SYBR Lo-ROX Kit (Bioline, NSW, Australia), respectively ...
-
bioRxiv - Immunology 2021Quote: ... Sensifast cDNA synthesis kit (Bioline) was used to transcribe total RNA to cDNA ...
-
bioRxiv - Developmental Biology 2022Quote: ... No-ROX Kit (Bioline, USA), 150nM forward primer ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Every pair of dissected pectoral fins coming from a single larva was transferred to a separated 1.5 ml tube containing 50 μl of TRIsure (BIO-38032, Bioline) and kept at −20°C in until larvae were genotyped (see in situ hybridization section) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Reactions were performed in a total volume of 25 μl containing 12.5 μl 2 x MyTaq Red (Bioline, UK), 0.5 μl of each 10 μM primer stock ...
-
bioRxiv - Genetics 2020Quote: The optimized final reaction conditions were performed in a final volume of 25 μl containing 1.6X NH4 buffer (Bioline); 4 mM MgCl2 (Bioline) ...
-
bioRxiv - Neuroscience 2019Quote: A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...
-
bioRxiv - Physiology 2021Quote: ... was performed with three primers (Figure 1 A, “a”: AAGGCGCATAACGATACCAC, “b”: TACAATGCAGGCTCCAAACAC, “c”: CGAGCACAGGAAGTTCAACA, Eurofins Genomics, Ebersberg/Germany) and the ImmoMix™ kit (Bioline, Cat. No BIO-25020) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: RT-qPCR was performed in 20.0 µl final reaction volume containing 10.0 µl of 2X SensiMix SYBR® No-ROX master mix (Bioline, UK), 0.3 µM of forward and reverse primers and 1.0 µl of cDNA ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were generated in 25 µl reactions containing 12.5 µl Bioline PCR Master Mix (Bioline USA Inc, Taunton, MA), 10.0 µl MG H2O ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR amplification was performed in a total reaction mixture of 10 μL containing 1x SensiFast master mix (Bioline, Meridian Bioscience), 0.5 μM of reverse and forward primers ...
-
bioRxiv - Genetics 2023Quote: ... 2 µl aliquots of cDNA (corresponding to 20 ng of cDNA) were used in qPCR using SYBR green containing supermix (Bioline) on the Biorad CFX96 thermal cycler (Biorad ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Sensifast Hi-Rox SyBr kit (Bioline) was used to perform the RT-qPCR on a StepOnePlus system (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... and a SensiFast Probe kit (Bioline). Expression of tubulin was used to normalize the expression of target genes ...
-
bioRxiv - Plant Biology 2022Quote: ... and the qPCR SensiMix kit (BioLine, GC Biotech BV ...
-
bioRxiv - Physiology 2019Quote: ... SYBR® No-ROX Kit (Bioline) in an Applied Biosysems cycler (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... using SensiFAST cDNA Synthesis Kit (Bioline). The quality and concentration of template RNA and of cDNA were assessed with NanoDrop OneC Microvolume UV-Vis Spectrophotometer (ThermoFisher Scientific) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and SensiFAST cDNA Synthesis Kit (Bioline), respectively ...
-
bioRxiv - Microbiology 2023Quote: ... using SensiFAST SYBR® kit (Bioline) and primers specific for the membrane protein gene of HCoV-OC43 and HCoV-229E (Vijgen et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... We synthesized complementary DNA (cDNA) from 100ng of RNA in a 40μl reaction containing 100 units of Tetro Reverse transcriptase (Bioline, Taunton, MA), 8μl of 5X RT buffer ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 7μl of reaction mix containing primers (forward and reverse) at a final concentration of 300nM and Sensifast SYBR®Low-ROX Mix (Bioline). qPCR assays were performed on a Mic qPCR instrument (Bio Molecular Systems ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... We synthesized complementary DNA (cDNA) from 100 ng of RNA in a 40µl reaction containing 100 units of Tetro Reverse transcriptase (Bioline, Taunton, MA), 8µl of 5X RT buffer ...
-
bioRxiv - Microbiology 2020Quote: PCR products were purified using a commercial kit (Isolate II PCR and Gel Kit, Bioline, London, UK) and sent for sequencing (Macrogen Europe ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were set up in total volumes of 10 µl each, containing 5× MyTaq reaction buffer (5 mM dNTPs, 15 mM MgCl2, stabilizers and enhancers) (Bioline, London, UK), 2 µM of each primer ...
-
bioRxiv - Cell Biology 2020Quote: ... 25 ng cDNA were used in a total reaction mix of 20 μl containing 10 ul Sensi Fast SYBR Green Hi-Rox (Bioline, London, UK) as well as 400 nM forward and reverse primer (Supplementary Material and Methods ...
-
bioRxiv - Microbiology 2020Quote: All PCRs were carried out in 25 μl reaction volumes containing 0.05 units of MyTaq™ DNA Polymerase (Bioline Laboratories, London, UK), 1x MyTaq™ Mix (Bioline ...
-
bioRxiv - Neuroscience 2021Quote: ... In short myTaq extract-PCR kit (Bioline) was used to amplify a 300 bp fraction of the ath5 gene containing the lakritz mutation using the following primers ...
-
bioRxiv - Microbiology 2019Quote: ... using the SensiFast SYBR-NoRox kit (Bioline) in quadruplicate for each gDNA sample using primers listed in Suppl ...
-
bioRxiv - Immunology 2019Quote: ... and SensiFAST SYBR Lo-Rox kit (BioLine) were used ...
-
bioRxiv - Developmental Biology 2019Quote: ... with SensiMix SYBR Hi-ROX Kit (Bioline) following manufactures instructions ...