Labshake search
Citations for Bioline :
101 - 150 of 708 citations for Rat Alpha ketoglutarate dependent dioxygenase FTO FTO ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... and the SensiFAST™ SYBR® No-ROX Kit (Bioline), following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNAs were prepared using the SensiFAST cDNA Synthesis Kit (Bioline). Quantitative real-time PCR reactions using cDNA samples as template were carried out using a SensiFAST SYBR No-ROX Kit (Bioline ...
-
bioRxiv - Microbiology 2020Quote: ... Products were purified (Isolate II PCR and Gel kit, Bioline) and Sanger sequenced (Australian Genome Research Facility ...
-
bioRxiv - Cancer Biology 2020Quote: ... qPCRs were run using SensiFAST SYBR No-ROX Kit (Bioline) and a Roche LightCycler 384 ...
-
bioRxiv - Neuroscience 2022Quote: ... and quantitative PCR with the library quantification kit from Bioline Jet Set Library Quantification Kit LoROX (Meridian Bioscience ...
-
bioRxiv - Plant Biology 2021Quote: ... with the SensiMix Kit and SYBR Green (Bioline, Luckenwalde, Germany). Negative controls without template addition ...
-
bioRxiv - Neuroscience 2021Quote: ... 5μl SensiFAST SYBR Green No-ROX Kit (BIOLINE, BIO-98020), and 2μl of DNAse/RNAse-free water ...
-
bioRxiv - Microbiology 2021Quote: ... 125nM) and SensiFAST Probe Hi-ROX One-Step Kit (Bioline) according to the manufacturer’s instructions in a 20μl reaction with 5μl sample ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA preparation was performed using SensiFAST cDNA Synthesis Kit (Bioline) and real-time qPCR was performed using SensiFast SYBR Lo-ROX kit (Bioline) ...
-
bioRxiv - Immunology 2022Quote: ... obtained from the TaqMan RT-PCR kit (Bioline #BIO-78005), was added to a 15 ml tube ...
-
bioRxiv - Microbiology 2020Quote: ... The Sensi-FAST SYBR Hi-ROX One-Step Kit (Bioline) was used for quantitative real time PCR (qRT-PCR) ...
-
bioRxiv - Physiology 2020Quote: ... SensiFAST™ SYBR® Lo-ROX Kit (Bioline, TN, USA) was used to amplify cDNA using primers listed in Table S2 ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was reverse transcribed using SensiFast cDNA Synthesis Kit (Bioline), and SYBR green PCR analysis was performed using Kapa HiFi HotStart Ready Mix (Roche ...
-
bioRxiv - Physiology 2019Quote: ... reagent and ISOLATE II RNA Mini kit (Bioline, #BIO-52073). Isolated RNA was reverse transcribed using iScript cDNA Synthesis Kit (Biorad ...
-
bioRxiv - Cancer Biology 2019Quote: ... and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: RNA was isolated using ISOLATE II RNA Mini Kit (Bioline) according to the manufacturers’ instructions with minor adjustments ...
-
bioRxiv - Microbiology 2021Quote: ... braarudii cells using the Isolate II RNA Mini Kit (Bioline) with on column DNA digestion ...
-
bioRxiv - Microbiology 2021Quote: ... with Sensi-FAST Probe Hi-ROX qPCR kit (Bioline, 82005) (8).
-
bioRxiv - Immunology 2021Quote: ... using the SensiFAST SYBR No-ROX Kit (Bioline, Meridian Bioscience). Hprt1 was used as a housekeeping gene and the standard curve method was used for quantification ...
-
bioRxiv - Developmental Biology 2022Quote: ... purified using ISOLATE II PCR and Gel Kit (Bioline, Australia) and Sanger sequenced at the Australian Genome Resource Facility (AGRF) ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was recovered using a DNA purification kit (Bioline #52060). The binding levels of Gal4 and TBP were determined using qPCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... The protocol used the SensiFAST No-ROX kit (Bioline #98020) and a LightCycler 480 system for detection ...
-
bioRxiv - Microbiology 2022Quote: ... was extracted using genomic DNA extraction kit (Bioline, London, UK) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was synthesized using the SensiFast cDNA synthesis kit (Bioline) and SETD7 and GAPDH levels measured by qPCR were used as positive and negative control respectively ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was reverse transcribed by Tetro cDNA synthesis kit (Bioline) with the primer of ‘GAGCAAAGACCCCAACGAGA’ targeting MBaMV-GFP genome ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative PCR was performed using SensiFAST™ SYBR kit (BIOLINE). The primer sequences used for qPCR are listed in Table S1 ...
-
bioRxiv - Immunology 2023Quote: ... RNA was isolated using ISOLATE II RNA Mini Kit (Bioline) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline). Gene expression was measured using qRT-PCR using TaqMan (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline). Gene expression was measured using qRT-PCR using TaqMan (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was isolated using Isolate II RNA Mini Kit (Bioline) and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline) ...
-
bioRxiv - Genomics 2023Quote: ... qPCR was performed using the SensiFAST SYBR NoROX Kit (Bioline) supplemented with 0.2μM of specific primer pairs (Table S9 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Reactions were performed with SensiFAST SYBR Hi-ROX kit (Bioline), and all samples and negative controls were run in technical duplicate on an Applied Bioscience StepOnePlus qPCR machine (Life Technologies).
-
bioRxiv - Neuroscience 2023Quote: ... and reverse transcribed using the SensiFast cDNA Synthesis Kit (Bioline). Quantitative real-time PCR was performed in triplets for each sample using the LightCycler DNA Master SYBR Green I Kit in a LightCycler 480 System (Roche) ...
-
bioRxiv - Cell Biology 2023Quote: ... and cDNA was synthesized using a SensiFast cDNA kit (Bioline) using manufacturer’s instructions from 250 ng of RNA ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA was generated using the Tetro cDNA Synthesis Kit (Bioline) and the Uni12 primer (5’-AGCAAAAGCAGG-3’ ...
-
bioRxiv - Developmental Biology 2024Quote: ... using the Sensifast SYBR no Rox kit (Bioline, BIO-98020). Data analysis and visualisation was performed using Microsoft Excel (Office 365 ...
-
bioRxiv - Cell Biology 2020Quote: ... qPCR was performed using the SensiFAST SYBR No-ROX Kit (Bioline). Primers used to quantify FLOE1 expression were priqPCRFLOE1set1-FWD/REV (Table S3) ...
-
bioRxiv - Immunology 2021Quote: ... Real-time RT-PCR using SensiFast SYBR No-Rox kit (Bioline) was performed to determine gene expression ...
-
bioRxiv - Genetics 2021Quote: ... cDNA was synthesized using the SensiFast cDNA synthesis kit (Bioline, USA), and qPCR was done using the SYBR green mix (Bio-Rad ...
-
bioRxiv - Genetics 2021Quote: ... cDNA was synthesized using the SensiFast cDNA synthesis kit (Bioline, USA), and qPCR was done using the SYBR green mix (Bio-Rad ...
-
bioRxiv - Developmental Biology 2021Quote: RNA was isolated using the ISOLATE II RNA Mini Kit (Bioline) following manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2020Quote: ... The SensiMix SYBR No-ROX kit was from Bioline (London, UK). SmaI was from New England Biolabs (Ipswich ...
-
bioRxiv - Molecular Biology 2021Quote: ... a SensiFAST™ SYBR® No-ROX Kit (Bioline, London, UK) was used to perform the qPCR ...
-
bioRxiv - Molecular Biology 2021Quote: qPCRs were performed using SensiFastTM SYBR® Lo-ROX kit (Bioline). A master mix for each primer pair was prepared following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... and column purified using ISOLATE II RNA Mini Kit (Bioline, Australia) according to the manufacturer’s instruction ...
-
bioRxiv - Immunology 2020Quote: RNA was isolated using the ISOLATE II RNA Mini Kit (Bioline) following the manufacturer’s guidelines ...
-
bioRxiv - Cancer Biology 2019Quote: ... Synthesis of cDNA was performed using Sensifast cDNA Synthesis Kit (Bioline) according to the manufacturer’s instructions ...
-
Virus-mediated transient expression techniques enable genetic modification of Alopecurus myosuroidesbioRxiv - Genetics 2020Quote: ... or Isolate II PCR and Gel Kit (Bioline cat# BIO-52059) according to the manufacturer’s protocols ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... with a MyTaq HS Red Mix PCR kit (Bioline, Eveleigh, Australia). Each 20 μL reaction contained 5 μL of MilliQ water ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was reverse transcribed with the Tetro cDNA synthesis kit (Bioline) according to manufacturer’s instructions ...