Labshake search
Citations for Bioline :
1 - 50 of 788 citations for Prolactin PRL ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... qPCR was performed in 96-well plates using the SensiFastTM SYBR No-ROX Kit (Bioline) in technical triplicates for each biological replicate ...
-
bioRxiv - Plant Biology 2023Quote: Measurements were carried out in 96-well plates using the SensiFAST™ SYBR® Kit (Bioline, Luckenwalde, Germany) in a LightCycler® 480 (Roche) ...
-
bioRxiv - Physiology 2022Quote: ... qPCRs were carried out in 15 μl in a 384-well plate using SensiFASTTM SYBR Hi-ROX kit (Bioline), 0·5 μM of each forward and reverse primer and 2·5 μl of template DNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL 1:1 diluted cDNA and SensiFAST SYBR No-ROX Kit (#BIO-98005, Bioline). Knockdown was assessed using ΔΔCt analysis as described by Pfaffl [92].
-
bioRxiv - Biochemistry 2022Quote: ... RNA samples (1 µg) were reverse transcribed using SensiFAST cDNA synthesis kit (Bioline) according to manufacturer’s protocol and subjected to Real-time quantitative PCR (RT-qPCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... qPCRs were run using 2 µl cDNA (diluted 1:1) in a 10 µl reaction with 5 µl SensiFAST SBYR No-ROX Kit (Bioline) and 0.1 µM of each primer ...
-
bioRxiv - Plant Biology 2020Quote: ... 1 μg of total RNA was reverse transcribed with SensiFAST cDNA Synthesis Kit (Bioline) according to the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2022Quote: ... cDNA was synthesized from 1 µg RNA samples using SensiFAST cDNA synthesis kit (Bioline) according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... The total qPCR reaction volume was 1.5 μl and consisted of 0.5 μl of cDNA (dilution 1/12) and 1 μl of SensiFAST™ SYBR® No-ROX Kit (Bioline) containing 0.4 μM of PCR primer (Eurogenetec SA)(primer list in sup ...
-
bioRxiv - Immunology 2023Quote: ... the aqueous phase was mixed 1:1 v/v with 70% ethanol and loaded into a column of the Isolate II RNA Mini kit (Bioline, Cincinnati, OH). Total RNA was purified following the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA was synthesized from 1 µg total RNA using cDNA synthesis kit (Bioline, Sydney, Australia) and RT-PCR was performed using the SYBR® Select Master Mix (Thermofisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesized from 1 μg of purified RNA with a SensiFast cDNA synthesis kit (Bioline). The primers used are listed in Table S2 (Supplementary Material) ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.5-1 μg of total RNA was retrotranscribed using SensiFAST cDNA Synthesis Kit (BioLine, London, UK). Real-time PCR was performed using iTaq qPCR master mix according to manufacturer’s instructions (Bio-Rad ...
-
bioRxiv - Cancer Biology 2022Quote: ... Isolated RNA was used (1 μg) to make cDNA using SensiFASTTM Kit (Bioline Cat. Bio-65053). qPCR master mix was prepared using iTaq universal SYBR green supermix (Bio-Rad Cat ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 mg of total RNA was retrotranscribed in cDNA using the SensiFAST cDNA Synthesis KIT (Bioline). Specific sets of primer pairs were designed and tested with primerBLAST (NCBI ...
-
bioRxiv - Molecular Biology 2023Quote: ... and diluted 1:10 before quantification using the SensiFAST SYBR No-Rox kit (Bioline, BIO-98005). qRT-PCR was performed with 1 μM of each primer (a common reverse primer for both Trm1 isoforms and isoform-specific forward primers ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA was generated from 1 µg of RNA using the SensiFAST cDNA synthesis kit (Bioline, #BIO65054). cDNA was then diluted (1:5 ...
-
Increased ACTL6A Occupancy Within mSWI/SNF Chromatin Remodelers Drives Human Squamous Cell CarcinomabioRxiv - Molecular Biology 2021Quote: ... cells were lysed directly on culture plates with TRIsure reagents (Bioline), and RNA was extracted using Direct-zol RNA MiniPrep kits (Zymo Research ...
-
bioRxiv - Physiology 2021Quote: ... cDNA synthesis was performed with 1 µg RNA (SensiFAST™ cDNA Synthesis Kit, Bioline, Cat# BIO-65053), according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... qRT-PCR was carried out on 1:10 diluted cDNA using Sensifast Hi-Rox Sybr kit (Bioline). Two qRT-PCR reactions (technical replicates ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1 µg of RNA was reverse transcribed to cDNA using SensiFAST cDNA Synthesis Kit (Bioline #65054). qPCR reactions were set up using PowerUp SYBR Green Master Mix (Applied Biosystems #A25742 ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was retrotranscribed from 0.3 µg to 1 µg using the SensiFAST cDNA Synthesis Kit (Bioline, BIO-65054). Real-time PCR was performed on the CFX384 Touch Real-time PCR Detection System (Bio-Rad ...
-
bioRxiv - Genetics 2021Quote: ... 1 µg of total RNA was reverse transcribed using SensiFAST cDNA Synthesis Kit following the manufacturer’s protocol (Bioline).
-
bioRxiv - Microbiology 2021Quote: ... 1:10 dilutions of RNA samples were analyzed using SensiFast SYBR Hi-ROX One-Step kit (Bioline, UK) and 400 nM primer concentrations ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was reverse-transcribed (1 mg each experimental point) by using SensiFAST cDNA Synthesis Kit (BIO-65053, Bioline) and qPCR was performed as described (18 ...
-
bioRxiv - Genetics 2023Quote: ... 1 µg of RNA was used to prepare cDNA using the Sensifast cDNA synthesis kit (Bioline, London, UK). 2 µl aliquots of cDNA (corresponding to 20 ng of cDNA ...
-
bioRxiv - Genetics 2021Quote: ... RNA was reverse-transcribed (1 µg each experimental point) by using SensiFAST™ cDNA Synthesis Kit (BIO-65053, Bioline) and qPCR was performed using SensiFast Sybr Lo-Rox Mix (BIO-94020 ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA was made from 1 ug total RNA using Tetro cDNA synthesis kit with DNase treatment according to manufacturer’s instructions (Bioline). cDNA was diluted into 100 ul and 2 ul of cDNA was used to perform qRT-PCR ...
-
bioRxiv - Neuroscience 2022Quote: ... RT-qPCR was performed with 1/10 diluted cDNA with the SensiFAST SYBR no-rox kit (Bioline, London, UK) and Lightcycler® 480 (Roche Molecular Biochemicals ...
-
bioRxiv - Plant Biology 2023Quote: ... Real-time RT-PCR was performed on 1:10 diluted cDNA using the SensiFAST SYBR No-ROX Kit (Bioline). Three biological and technical replicates were analyzed per genotype ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.25– 1 µg of RNA was reverse-transcribed into cDNA using the SensiFAST cDNA Synthesis Kit (Bioline, BIO-65054). Real-time PCR was performed on the CFX384 Touch real-time PCR detection system (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... For RT-qPCR cDNA was prepared from 1 µg of total RNA using the SensiFAST cDNA Synthesis Kit (BIO-65054, Bioline) and analysed by qPCR using the SensiFast SYBR Lo-ROX Kit (BIO-94050 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... qRT-PCR was carried out on 1:10 diluted cDNA on an Applied Biosystems StepOnePlus system using Sensifast Hi-Rox Sybr kit (Bioline). Cycle conditions were as follows ...
-
bioRxiv - Cell Biology 2021Quote: mRNA was isolated using NucleoSpin® RNA Plus (Machery-Nagel) and 1 µg of total mRNA was reverse-transcribed into cDNA using SensiFASTTM cDNA Synthesis Kit (Bioline) according to the manufacture’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Isolated RNA (0.5-1 µg) was then used for reverse transcription into first strand cDNA via a SensiFast cDNA synthesis kit (Bioline). RNA spike I (TATAA ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... qRT-PCR was carried out on 1:2 diluted cDNA on an Applied Biosystems StepOnePlus system using a Sensifast Hi-Rox SYBR kit (Bioline). Cycle conditions were as follows ...
-
bioRxiv - Molecular Biology 2023Quote: ... and vehicle was added to control plates 24 hours before RNA isolation using Trisure (Bioline) per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Each reaction (20 μL) consisted of 1 μL of cDNA substrate and 19 μL of a SensiFAST No-ROX Kit Master Mix (Bioline, UK). Following primer optimisation ...
-
bioRxiv - Developmental Biology 2020Quote: cDNA was diluted 1:10 in nuclease-free water and subsequently applied for qRT-PCR using the SensiFast™SYBR HiROX Kit (Bioline) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 ng of the total RNA was reverse-transcribed into cDNA using a Tetro cDNA synthesis kit (BIO-65042, Bioline, London, UK). Quantitative PCR (RT-qPCR ...
-
bioRxiv - Microbiology 2019Quote: ... using the amplification kit SensiFAST SYBR No-Rox kit (Bioline, London, UK), according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... A total of 1 µg of total RNA was used to initiate cDNA synthesis using the SensiFAST™ cDNA Synthesis Kit (Bioline, London, UK). The SYBR Green assay with SensiFAST™ SYBR no ROX kit was used for the quantification of transcripts in RT-PCR ...
-
bioRxiv - Genetics 2022Quote: ... The Endpoint PCR amplification (gDNA concentration of 20-50 ng μl−1 per sample) for each target region were performed using MyFi™ DNA Polymerase Kit (Bioline GmbH, Luckenwalde, Germany) and specific primers (IDENTXX GmbH)in a PCR thermal cycler (T100 PCR thermal cycler ...
-
bioRxiv - Bioengineering 2022Quote: ... SensiFAST cDNA Synthesis Kit and the SensiFAST SYBR Lo-ROX Kit (Bioline, NSW, Australia), respectively ...
-
bioRxiv - Immunology 2021Quote: ... Sensifast cDNA synthesis kit (Bioline) was used to transcribe total RNA to cDNA ...
-
bioRxiv - Developmental Biology 2022Quote: ... No-ROX Kit (Bioline, USA), 150nM forward primer ...
-
bioRxiv - Neuroscience 2019Quote: A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...
-
bioRxiv - Physiology 2021Quote: ... was performed with three primers (Figure 1 A, “a”: AAGGCGCATAACGATACCAC, “b”: TACAATGCAGGCTCCAAACAC, “c”: CGAGCACAGGAAGTTCAACA, Eurofins Genomics, Ebersberg/Germany) and the ImmoMix™ kit (Bioline, Cat. No BIO-25020) according to the manufacturer’s instructions.
-
bioRxiv - Evolutionary Biology 2020Quote: ... Sensifast Hi-Rox SyBr kit (Bioline) was used to perform the RT-qPCR on a StepOnePlus system (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... and a SensiFast Probe kit (Bioline). Expression of tubulin was used to normalize the expression of target genes ...