Labshake search
Citations for Bioline :
151 - 194 of 194 citations for PD 1 Human C93S HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Agarose gels (1.5%) were prepared in 1 X TAE buffer (Astral Scientific) with 0.01% SYBR Safe DNA gel stain (Bioline). PCR products (5 µL ...
-
bioRxiv - Molecular Biology 2022Quote: ... 30 μl of 86.6% (5:1) diluted MyTaq HotStart Red Mix in water (Bioline, cat. no. BIO-25048) and 10 μl of 1 μM of each primer (TAC0007 and TAC0012 final concentration of 200 nM ...
-
bioRxiv - Evolutionary Biology 2022Quote: Electrophoresis of the Round 2 Multiplex-Nested-PCR product was performed on a 1% agarose (Molecular grade, Bioline) gel ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was reverse-transcribed (1 mg each experimental point) by using SensiFAST cDNA Synthesis Kit (BIO-65053, Bioline) and qPCR was performed as described (18 ...
-
bioRxiv - Genetics 2023Quote: ... 1 µg of RNA was used to prepare cDNA using the Sensifast cDNA synthesis kit (Bioline, London, UK). 2 µl aliquots of cDNA (corresponding to 20 ng of cDNA ...
-
bioRxiv - Microbiology 2024Quote: ... 1 ng/μl of total DNA was amplified using the primer sets in SensiFAST SYBR No-ROX (Bioline). qPCR was realized in technical duplicates in the Rotor-Gene Q real-time PCR cycler (Qiagen) ...
-
bioRxiv - Genetics 2021Quote: ... RNA was reverse-transcribed (1 µg each experimental point) by using SensiFAST™ cDNA Synthesis Kit (BIO-65053, Bioline) and qPCR was performed using SensiFast Sybr Lo-Rox Mix (BIO-94020 ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA was made from 1 ug total RNA using Tetro cDNA synthesis kit with DNase treatment according to manufacturer’s instructions (Bioline). cDNA was diluted into 100 ul and 2 ul of cDNA was used to perform qRT-PCR ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was synthesized from 1 μg of total RNA using Oligo (dT) and Super Script Reverse Transcriptase III (Bioline). GoTaq qPCR Master Mix (Thermofischer ...
-
bioRxiv - Developmental Biology 2019Quote: ... 0.4 μM zebrafish genotyping primers (Extended Data Fig.5A, Table 2) and 1 x MyTaq Red DNA Polymerase (Bioline) according to the manufacturer’s protocol in a T100 thermal cycler ...
-
bioRxiv - Molecular Biology 2019Quote: ... 15 pmol of each forward primer 341F 5’-NNNNNNNNNNTCCTACGGGNGGCWGCAG and reverse primer 785R 5’-NNNNNNNNNNTGACTACHVGGGTATCTAAKCC in 20 μL volume of 1 x MyTaq buffer containing 1.5 units MyTaq DNA polymerase (Bioline) and 2 μl of BioStabII PCR Enhancer (Sigma) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and expression of His3-SUMO-AscA (or His3-SUMO-AscAΔMBD) was induced using 1 mM isopropyl-thio-galactoside (IPTG; Bioline) overnight at 18°C ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 1 mM EDTA and 50 mM NaCl) (Yeap et al. 2014) with proteinase K at a concentration of 12.5 μl ml−1 (Bioline). Samples were then incubated for 5 min at 56 °C and 5 min at 95 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Approximately 100 mg of grounded tissue per sample was homogenized in 1 mL of the commercial reagent TRIsure (Bioline), and total RNA was extracted following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... 1 μl forward and reverse primers (10 mM) and 0.5 μl (5 U/μl) BioTaq DNA polymerase (Bioline, London) and amplified using PCR thermal cycler (BiometraTOne ...
-
bioRxiv - Neuroscience 2022Quote: ... RT-qPCR was performed with 1/10 diluted cDNA with the SensiFAST SYBR no-rox kit (Bioline, London, UK) and Lightcycler® 480 (Roche Molecular Biochemicals ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2.5 µl of 1:10 diluted immunoprecipitation output was added to 7.5 µl of Sensi-FAST SYBR No-ROX (Bioline) and 400 nM of forward and reverse primers in a 15 µl final volume ...
-
bioRxiv - Neuroscience 2022Quote: ... Dehydrated samples were rehydrated through a series of methanol/PBS washes for 10 minutes each at room temperature with an additional 3 x 10 minutes PBSTw (0.1% Tween-20) and treated with proteinase K (1:1000, Bioline) for 20 minutes to increase permeabilization ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2.5 µl of 1:10 diluted cDNA was added to 7.5 µl of Sensi-FAST SYBR No-ROX (Bioline) and 400 nM of forward and reverse primers in a 15 µl final volume ...
-
bioRxiv - Plant Biology 2023Quote: ... Real-time RT-PCR was performed on 1:10 diluted cDNA using the SensiFAST SYBR No-ROX Kit (Bioline). Three biological and technical replicates were analyzed per genotype ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2.5 µl of 1:10 diluted cDNA was added to 7.5 µl of Sensi-FAST SYBR No-ROX (Bioline) and 400 nM of forward and reverse primers in a 15 µl final volume ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.25– 1 µg of RNA was reverse-transcribed into cDNA using the SensiFAST cDNA Synthesis Kit (Bioline, BIO-65054). Real-time PCR was performed on the CFX384 Touch real-time PCR detection system (Bio-Rad ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR was done using gene-specific primers (see Supplemental Table 1) in technical triplicates on a LightCycler 480 system using the Sensifast SYBR Master mix (Bioline). The ratio of experimental target mRNA to an ACTIN control for each sample was calculated by Applied Biosystems software ...
-
bioRxiv - Molecular Biology 2020Quote: ... For RT-qPCR cDNA was prepared from 1 µg of total RNA using the SensiFAST cDNA Synthesis Kit (BIO-65054, Bioline) and analysed by qPCR using the SensiFast SYBR Lo-ROX Kit (BIO-94050 ...
-
Safety and efficacy of C9ORF72-repeat RNA nuclear export inhibition in amyotrophic lateral sclerosisbioRxiv - Systems Biology 2021Quote: ... 1 µg RNA (iNeurons samples) or 2 µg RNA (Drosophila samples) was converted to cDNA using BioScript Reverse Transcriptase (Bioline). qRT–PCR primers were designed using Origene or Primer-BLAST and validated using a 1 in 4 serial template dilution series (standard curve with R2>0.97) ...
-
bioRxiv - Plant Biology 2021Quote: ... Amplicons for sequencing were generated by PCR using degenerate primers (see Supplemental Table 1) for each locus using My Taq HS mix (Bioline) and gel purification ...
-
bioRxiv - Microbiology 2020Quote: ... Real-time PCR reactions were performed in 12 μL mixtures containing 1 x SensiFAST SYBR No-ROX mix (Bioline, Australia), 400 nM of each forward and reverse primer (Table 3 ...
-
bioRxiv - Immunology 2022Quote: ... DNA amplifications for the conTRT amplicons were performed similarly except Ranger DNA polymerase (1×10-6 approximate error/bp) from Bioline was utilized ...
-
bioRxiv - Neuroscience 2019Quote: ... PCR reactions were performed using 5μl cDNA mix and 200nM custom-designed primers (Table 1) and SensiMix (Bioline, London, UK). qPCR data were analysed using ΔCt methods as described previously [Isles et al. ...
-
bioRxiv - Plant Biology 2020Quote: ... Final elution was performed with 40 µl DNA/RNAase-Free water supplied and the eluted RNA was subsequently quantified using a ND-1000 Spectrophotometer (NanoDrop Technologies) and quantified on a 1% (w/v) agarose gel (Bioline) by electrophoresis ...
-
bioRxiv - Cell Biology 2021Quote: mRNA was isolated using NucleoSpin® RNA Plus (Machery-Nagel) and 1 µg of total mRNA was reverse-transcribed into cDNA using SensiFASTTM cDNA Synthesis Kit (Bioline) according to the manufacture’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... Presence of the subfamilies in the genomes of additional strains (Table 1) was tested by PCR using the MyTaq polymerase (Bioline) and the primers listed in Sup ...
-
bioRxiv - Cancer Biology 2023Quote: ... Isolated RNA (0.5-1 µg) was then used for reverse transcription into first strand cDNA via a SensiFast cDNA synthesis kit (Bioline). RNA spike I (TATAA ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... 20 µl of the epPCR served as a template for a second 1 ml standard PCR with 25 cycles using BioTaq polymerase (Bioline) and primers CW1&2 as previously described49 ...
-
bioRxiv - Microbiology 2021Quote: ... Each reaction (20 μL) consisted of 1 μL of cDNA substrate and 19 μL of a SensiFAST No-ROX Kit Master Mix (Bioline, UK). Following primer optimisation ...
-
bioRxiv - Developmental Biology 2020Quote: cDNA was diluted 1:10 in nuclease-free water and subsequently applied for qRT-PCR using the SensiFast™SYBR HiROX Kit (Bioline) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... and 1 μL of the obtained cDNA was used for real-time PCR with SYBR™ green master mix (Bioline, Luckenwalde, Germany) on a C1000 Touch™ Thermal Cycler (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 ng of the total RNA was reverse-transcribed into cDNA using a Tetro cDNA synthesis kit (BIO-65042, Bioline, London, UK). Quantitative PCR (RT-qPCR ...
-
bioRxiv - Plant Biology 2023Quote: ... A total of 1 µg of total RNA was used to initiate cDNA synthesis using the SensiFAST™ cDNA Synthesis Kit (Bioline, London, UK). The SYBR Green assay with SensiFAST™ SYBR no ROX kit was used for the quantification of transcripts in RT-PCR ...
-
bioRxiv - Genetics 2022Quote: ... The Endpoint PCR amplification (gDNA concentration of 20-50 ng μl−1 per sample) for each target region were performed using MyFi™ DNA Polymerase Kit (Bioline GmbH, Luckenwalde, Germany) and specific primers (IDENTXX GmbH)in a PCR thermal cycler (T100 PCR thermal cycler ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell were propogated in either LB or TB media and protein expression was performed by inducing with 0.5 mM IPTG (Isopropyl ß-D-1-thiogalactopyranoside, Bioline, Cat No. BIO-37036) overnight at 180C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... from Mediterranean and temperate species had germinated we transplanted up to 20 seedlings each into 9 × 9 cm pots (one plant per pot) with a 3:1 mixture of potting soil (Einheitserde®, BioLine, Topfsubstrat Öko torffrei) and sand (0-2 mm play sand ...
-
bioRxiv - Neuroscience 2019Quote: A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...
-
bioRxiv - Physiology 2021Quote: ... was performed with three primers (Figure 1 A, “a”: AAGGCGCATAACGATACCAC, “b”: TACAATGCAGGCTCCAAACAC, “c”: CGAGCACAGGAAGTTCAACA, Eurofins Genomics, Ebersberg/Germany) and the ImmoMix™ kit (Bioline, Cat. No BIO-25020) according to the manufacturer’s instructions.