Labshake search
Citations for Bioline :
201 - 250 of 953 citations for PCR Product Purification kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... and the resulting pool was purified by phenol-chloroform extraction followed by gel purification (BIO-52059; Bioline). The purified DNA fragments were then blunted and phosphorylated using End-It DNA End-Repair Kit (#ER0720 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and PCR amplification (Bioline, Taunton, MA). The libraries were sequenced by multiplexing 8 libraries per lane on the Illumina HiSeq2500 sequencer ...
-
bioRxiv - Microbiology 2020Quote: ... MyTaq Red PCR Mix (Bioline, UK) and 200 nM sense/anti-sense primers and amplification following 35 cycles of 95°C ...
-
bioRxiv - Bioengineering 2023Quote: ... My Taq PCR master mix (Bioline) that included buffer ...
-
bioRxiv - Plant Biology 2024Quote: ... PCR was performed using MyTaq (Bioline) DNA Polymerase in reactions containing 30ng of DNA template ...
-
bioRxiv - Molecular Biology 2021Quote: Ear biopsies from 21 days old mice were digested in MyTaq Extract PCR kit according to the manufacturer (Bioline, Cat number BIO-21126). PCR amplification was performed using the high-fidelity enzyme Q5 from New England Biolab (NEB ...
-
bioRxiv - Genomics 2021Quote: ... One-step reverse-transcription quantitative PCR (RT-qPCR) was performed with the SensiFAST™ SYBR® No-ROX One-Step kit (Bioline®) on an Eco™ Real-Time PCR System (Ilumina® ...
-
bioRxiv - Immunology 2023Quote: ... Quantitative PCRs (qPCRs) were performed on cDNA samples using SensiFAST™ SYBR® Hi-ROX or SensiFAST™ Probe No-ROX kits (Bioline) on a StepOnePlus real-time PCR apparatus (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative PCR was performed on 6,25ng of cDNA using the SensiFAST™ SYBR® No-ROX kit (Bioline, Meridian Life Science© Company) and a LightCycler® 480 Detection system (Roche) ...
-
bioRxiv - Plant Biology 2024Quote: ... cDNAs were diluted to 50 µL and used as template for Real-Time PCR monitored by SensiFast SYBR No-Rox Kit (Bioline, Cincinatti, OH, USA). RT-PCR was performed in the Roche Light Cycler 480 using primers for CAH4 ...
-
bioRxiv - Plant Biology 2019Quote: ... The 15 μl PCR cocktail consisted of 7.5 μl of PCR MyTaq Red Mix (Bioline, GmbH, Germany), 1.0 μl of genomic DNA template (70 ng/μl) ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative PCR or RT-PCR analyses were performed using Brilliant III SYBR green QPCR master mix (Bioline) with gene-specific primers on a Applied Bioscience StepOnePlus qPCR machine (Life Technologies) ...
-
bioRxiv - Microbiology 2021Quote: ... The 15 µl PCR reaction mixture contained 1x of MyTaq ™ Red PCR Mix (Bioline, South Africa), primers at 0.2 µM ...
-
bioRxiv - Molecular Biology 2019Quote: ... qRT-PCR was carried out with specific primer sets (listed in Supplementary Table 10) using SensiFAST™ SYBR® No-ROX Kit (BIOLINE, BIO-98005) and CFX Connect Real-Time PCR Detection System (BIO-RAD ...
-
bioRxiv - Microbiology 2021Quote: The origin of viral genes present in samples were determined by gene-specific reverse transcription polymerase chain reaction (RT-PCR) using a SensiFast Probe No-ROX one-step reverse transcription kit (Bioline, Meridian Biosciences, Ohio, USA). Each 20 µL reaction contained 5 μl of virus sample in 0.05% Triton-X 100 ...
-
bioRxiv - Physiology 2020Quote: ... using SYBR Green PCR master mix (Bioline). Data is represented as 2^-ΔCt compared to average of PC1/3 in healthy group ...
-
bioRxiv - Synthetic Biology 2020Quote: ... PCR reactions were conducted using MyTaq (Bioline) DNA polymerase ...
-
Psi promotes Drosophila wing growth through transcriptional repression of key developmental networksbioRxiv - Developmental Biology 2020Quote: ... PCR using MyTaq polymerase (Bioline BIO-21113) was performed with 3 long extension cycles followed by 17 short extension cycles as described (Vogel ...
-
bioRxiv - Neuroscience 2019Quote: A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...
-
bioRxiv - Developmental Biology 2019Quote: ... PCR reactions were resolved in 1 % agarose (Bioline) gels containing 0.5 μg/ml Ethidium Bromide (Sigma ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCRs were conducted using SensiFast (Bioline, London, UK) on the CFX384 RT-PCR detection system (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2024Quote: ... utilizing SensiFast Lo-ROX qRT-PCR Mastermix (Bioline) in both biological and technical triplicate ...
-
bioRxiv - Plant Biology 2019Quote: ... The amplification products were run on a 1.5% agarose gel with size marker Hyperladder™ 1kb (Bioline, UK). DNA bands (∼ 500 bp ...
-
bioRxiv - Neuroscience 2019Quote: ... Amplified products were visualized with reference to DNA ladders (either: Hyperladder I, Bioline, London, UK, or 1kb ladder, Promega), using GeneSnap (Syngene ...
-
bioRxiv - Microbiology 2021Quote: ... For the PCR master mix (MM) MangoTaq DNA polymerase and MyTaq DNA Polymerase were used and all PCR reagents were from Bioline (London, UK). To reduce the PCR inhibitors 0.4 μg μL−1 of bovine serum albumin (BSA ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR was performed with BIOTAQ DNA Polymerase (Bioline, UK) using the following program ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR of cDNA was performed using MyFi Taq (Bioline) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... qRT-PCR analysis was performed using SensiFast SYBR (BioLine) and gene-specific primers (Supplementary Table 3 ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR was conducted using BIOTAQ DNA polymerase (Bioline, USA). PCR conditions consisted of an initial denaturation step at 94°C for 1 min and 30 cycles of amplification ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR was performed with 2x MyTaq HS Mix (Bioline), using the following Hnrnpu primers ...
-
bioRxiv - Plant Biology 2022Quote: ... Converted DNA was PCR-amplified by MyTaq polymerase (Bioline) for 12 cycles ...
-
bioRxiv - Zoology 2019Quote: ... PCRs included 0.5 U MyTaq HS Mix polymerase (Bioline), 1 μL of DNA template ...
-
bioRxiv - Molecular Biology 2020Quote: ... and amplified via PCR using MyTaq DNA polymerase (Bioline).
-
bioRxiv - Cell Biology 2019Quote: ... qRT-PCR was performed using SensiMix SYBR Green (Bioline) on a QIAGEN Rotor-Gene Q ...
-
bioRxiv - Genetics 2022Quote: PCRs were performed using MyTaq HS DNA Polymerase (Bioline). Reaction mixes contained 5 μl 5x MyTaq Reaction Buffer ...
-
bioRxiv - Genomics 2022Quote: ... and amplified via PCR using MyTaq DNA polymerase (Bioline). Following amplification ...
-
bioRxiv - Plant Biology 2022Quote: ... Converted DNA was PCR-amplified by MyTaq polymerase (Bioline) for 12 cycles ...
-
bioRxiv - Genetics 2023Quote: PCR validations were performed using MyTaq DNA polymerase (Bioline), including 20 pmol of each primer (Additional file 6) ...
-
bioRxiv - Microbiology 2023Quote: ... qRT-PCR analysis was performed using SensiFast SYBR (BioLine) and gene-specific primers (nLuc FWD 5’ CAGCCGGCTACAACCTGGAC 3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... and RT-PCR performed using MyTaq DNA polymerase (Bioline). Fifty cycles of PCR were performed in order to identify low expressed transcripts ...
-
bioRxiv - Genomics 2023Quote: ... Bisulfite PCR reactions used MyTaq HS DNA polymerase (Bioline), and contained 1× reaction buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR was performed using MyTaq HS Red Mix (Bioline) with 66°C annealing and 15s elongation ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Quantitative PCR was carried out using CTS gene specific primer pairs (Supplemental Data 8) with SYBR green-based visualization of product amplification (Bioline). Changes in CTS gene transcript levels relative to Actin (ACT1 ...
-
bioRxiv - Microbiology 2022Quote: ... and conducted at 100V for 30 min with product size approximated using HyperLadder II 50bp DNA marker (Bioline, Sydney, Australia).
-
bioRxiv - Molecular Biology 2019Quote: ... cDNA was quantified using SYBR Green PCR master mix (Bioline) and normalized to Hypoxanthine-guanine phosphoribosyltransferase (Hprt ...
-
bioRxiv - Plant Biology 2021Quote: ... 35 rounds of PCR were performed using Mango Taq (Bioline) under standard conditions ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR was performed with MyTaq DNA or Myfi Polymerases (Bioline) and primers were designed (Suppl ...
-
bioRxiv - Developmental Biology 2022Quote: ... The DNA was PCR amplified using the MyTaq polymerase (Bioline). DNA was sonicated to an average size of 300bp and adaptors were removed by AlwI (NEB ...
-
bioRxiv - Cancer Biology 2019Quote: ... Amplicon PCR reaction was performed using 2x Accuzyme mix (Bioline) and 20 ng of DNA to amplify the barcode using the previously published primers sequences (Bhang et al. ...
-
bioRxiv - Microbiology 2021Quote: ... DNA fragments were amplified by PCR (Accuzyme DNA Polymerase, Bioline, or Supreme NZYProof DNA Polymerase ...