Labshake search
Citations for Bioline :
1 - 50 of 747 citations for Mouse Putative Phospholipase B Like 2 PLBD2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...
-
bioRxiv - Physiology 2021Quote: ... was performed with three primers (Figure 1 A, “a”: AAGGCGCATAACGATACCAC, “b”: TACAATGCAGGCTCCAAACAC, “c”: CGAGCACAGGAAGTTCAACA, Eurofins Genomics, Ebersberg/Germany) and the ImmoMix™ kit (Bioline, Cat. No BIO-25020) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL 1:1 diluted cDNA and SensiFAST SYBR No-ROX Kit (#BIO-98005, Bioline). Knockdown was assessed using ΔΔCt analysis as described by Pfaffl [92].
-
bioRxiv - Biochemistry 2020Quote: ... 2 µg of total RNA was used to prepare cDNA with SensiFast cDNA synthesis kit (Bioline) according to the manufacturer’s instructions and diluted 1:6 with DNAse/RNAse-free water (Thermo Fisher ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 RNA was converted to cDNA using the SensiFAST cDNA kit (#BIO-65053, BioLine) with 10 μL of RNA extract per reaction following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 2’dUTP and 2’dCTP were from Bioline Reagents (London ...
-
bioRxiv - Plant Biology 2020Quote: ... First-strand cDNA was made from 2 μg of RNA using the Tetro cDNA synthesis kit with DNase treatment according to manufacturer’s instructions (Bioline). cDNA was diluted 1 to 5 into RNAse free water to a total of 100 μl ...
-
bioRxiv - Immunology 2022Quote: ... Complementary DNA was synthesized using 2 µg of RNA and the Tetro cDNA synthesis kit (Bioline Reagents Ltd., London, UK) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... qPCRs were run using 2 µl cDNA (diluted 1:1) in a 10 µl reaction with 5 µl SensiFAST SBYR No-ROX Kit (Bioline) and 0.1 µM of each primer ...
-
bioRxiv - Immunology 2021Quote: ... Complementary DNA was synthesized using 2 μg of RNA and the Tetro cDNA synthesis kit (Bioline Reagents Ltd., London, UK) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... 1 μg of the entry vector was also digested with EcoRI-HF and NheI-HF and the linearised product was purified from a 2% agarose gel using PCR Isolate II PCR and Gel Kit (Bioline). The digested and purified reporter pool was then ligated into 80 ng of the linearised entry vector using Takara ligation kit v1.0 (#6021 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... qRT-PCR was carried out on 1:2 diluted cDNA on an Applied Biosystems StepOnePlus system using a Sensifast Hi-Rox SYBR kit (Bioline). Cycle conditions were as follows ...
-
bioRxiv - Microbiology 2023Quote: ... The reactions (10 μL total volume) contained 5 μL of 2 × SensiFAST™ SYBR No-ROX Kit (Bioline, London, UK), 0.2 μM of each arsM gene primer ...
-
bioRxiv - Immunology 2022Quote: ... genomic DNA (gDNA) was isolated from mouse brains or dural meninges using the Isolate II Genomic DNA Kit (Bioline, BIO-52067) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: Parasite genomic DNA was isolated from mouse peritoneal exudate cells and whole brain using the Isolate II Genomic DNA Kit (Bioline, BIO-52067). Prior to isolation ...
-
bioRxiv - Immunology 2023Quote: RNA was extracted from a total of 106 B cells purified from spleen or lymph nodes or 105 B cells sorted from the B:T co-cultures (72 h) using TRIsure™ (Bioline) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 2 μL of MyTaq™ 5x reaction buffer (Bioline), 0.08 μL of each primers ...
-
bioRxiv - Microbiology 2021Quote: ... and 2× My Taq Red (Bioline, Taunton, MA, USA). The PCR conditions were as follows ...
-
bioRxiv - Synthetic Biology 2022Quote: ... LB medium was supplemented with 2 mM IPTG (Bioline), 5 μg/mL chloramphenicol (MilliporeSigma) ...
-
bioRxiv - Genomics 2020Quote: ... 2 □1 water and 5□1 MyTaq™ HS Mix (Bioline). RT-PCR was performed in the following conditions ...
-
bioRxiv - Genomics 2022Quote: ... and run on a 2% agarose gel (Bioline, Cat#: BIO-41025) pre-stained with SYBR Safe Nucleic Acid Gel Stain (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products visualized by electrophoresis on 2% agarose (Bioline, London, UK) gel stained with SYBR Safe (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... using the amplification kit SensiFAST SYBR No-Rox kit (Bioline, London, UK), according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... SensiFAST cDNA Synthesis Kit and the SensiFAST SYBR Lo-ROX Kit (Bioline, NSW, Australia), respectively ...
-
bioRxiv - Immunology 2021Quote: ... Sensifast cDNA synthesis kit (Bioline) was used to transcribe total RNA to cDNA ...
-
bioRxiv - Developmental Biology 2022Quote: ... No-ROX Kit (Bioline, USA), 150nM forward primer ...
-
bioRxiv - Neuroscience 2020Quote: ... 20 μl of digest were run on 2 % agarose gel (BIOLINE, London, UK) and imaged on a trans illuminator ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR reactions were set up using SensiFast 2× Mastermix (Bioline Cat# BIO-94020) and oligonucleotides targeting genes of interest (IDT ...
-
bioRxiv - Neuroscience 2020Quote: ... qRT-PCR was performed using the 2× SYBR Green PCR Master Mix (Bioline) with the CFX96 detection system and analyzed with CFX Manager softward (Bio-rad) ...
-
bioRxiv - Genomics 2022Quote: ... PCR products were run on 0.8-2% agarose gels (Bioline, Cat#: BIO-41025), depending on fragment size ...
-
bioRxiv - Plant Biology 2020Quote: ... The digested product was visualized on a 2% (w/v) agarose gel (Bioline) by electrophoresis at 90 V for 90 min and the genotype of each line at the SNP position was confirmed according to the product bands on the gel ...
-
bioRxiv - Synthetic Biology 2022Quote: ... each well contained 1 mL LB agar supplemented with 2 mM IPTG (Bioline), 5 μg/mL chloramphenicol (MilliporeSigma) ...
-
bioRxiv - Genomics 2023Quote: ... 25 μL 2 x MyTaq HS Red Mix (Bioline, cat. no. BIO-25048), and plate-specific Illumina PCR indexed primers (TAC0012 and TAC0007 ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR products were separated by gel electrophoresis on 2% DNA grade agarose (Bioline) gels in TAE buffer (40 mM Tris Acetate ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Sensifast Hi-Rox SyBr kit (Bioline) was used to perform the RT-qPCR on a StepOnePlus system (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... and a SensiFast Probe kit (Bioline). Expression of tubulin was used to normalize the expression of target genes ...
-
bioRxiv - Plant Biology 2022Quote: ... and the qPCR SensiMix kit (BioLine, GC Biotech BV ...
-
bioRxiv - Physiology 2019Quote: ... SYBR® No-ROX Kit (Bioline) in an Applied Biosysems cycler (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... using SensiFAST cDNA Synthesis Kit (Bioline). The quality and concentration of template RNA and of cDNA were assessed with NanoDrop OneC Microvolume UV-Vis Spectrophotometer (ThermoFisher Scientific) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and SensiFAST cDNA Synthesis Kit (Bioline), respectively ...
-
bioRxiv - Microbiology 2023Quote: ... using SensiFAST SYBR® kit (Bioline) and primers specific for the membrane protein gene of HCoV-OC43 and HCoV-229E (Vijgen et al. ...
-
bioRxiv - Immunology 2024Quote: Total RNA was isolated from mouse tissues using TRIsure reagent (BIO-38033, Bioline Gmbh, Germany) and genomic DNA was digested using RNase-free DNase (rDNase ...
-
bioRxiv - Plant Biology 2020Quote: ... 2 μl of 1:10 diluted cDNA and BIOTAQ™ DNA polymerase (Bioline GmbH) were used in a CFX96™ Real-Time PCR Detection System (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2020Quote: PCR products were purified using a commercial kit (Isolate II PCR and Gel Kit, Bioline, London, UK) and sent for sequencing (Macrogen Europe ...
-
bioRxiv - Microbiology 2022Quote: ... Quantification of SFB in fecal mouse content was performed using the MasterMix SensiFAST™ SYBR (BIOLINE) and specific primer pair for_5‘-GACGCTGAGGCATGAGAGCAT-3‘ ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 2 μL of diluted cDNA were combined with 5 μL SYBR Green (Bioline, Luckenwalde, Germany), 0.2 μL of each forward and reverse primer and 4.6 μL DEPC-water ...
-
bioRxiv - Neuroscience 2021Quote: ... In short myTaq extract-PCR kit (Bioline) was used to amplify a 300 bp fraction of the ath5 gene containing the lakritz mutation using the following primers ...
-
bioRxiv - Microbiology 2019Quote: ... using the SensiFast SYBR-NoRox kit (Bioline) in quadruplicate for each gDNA sample using primers listed in Suppl ...
-
bioRxiv - Immunology 2019Quote: ... and SensiFAST SYBR Lo-Rox kit (BioLine) were used ...
-
bioRxiv - Developmental Biology 2019Quote: ... with SensiMix SYBR Hi-ROX Kit (Bioline) following manufactures instructions ...