Labshake search
Citations for Bioline :
151 - 200 of 729 citations for Mouse Proto oncogene Mas MAS1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... using the SensiFAST SYBR No-ROX Kit (Bioline, Meridian Bioscience). Hprt1 was used as a housekeeping gene and the standard curve method was used for quantification ...
-
bioRxiv - Developmental Biology 2022Quote: ... purified using ISOLATE II PCR and Gel Kit (Bioline, Australia) and Sanger sequenced at the Australian Genome Resource Facility (AGRF) ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was recovered using a DNA purification kit (Bioline #52060). The binding levels of Gal4 and TBP were determined using qPCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... The protocol used the SensiFAST No-ROX kit (Bioline #98020) and a LightCycler 480 system for detection ...
-
bioRxiv - Microbiology 2022Quote: ... was extracted using genomic DNA extraction kit (Bioline, London, UK) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was synthesized using the SensiFast cDNA synthesis kit (Bioline) and SETD7 and GAPDH levels measured by qPCR were used as positive and negative control respectively ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was reverse transcribed by Tetro cDNA synthesis kit (Bioline) with the primer of ‘GAGCAAAGACCCCAACGAGA’ targeting MBaMV-GFP genome ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative PCR was performed using SensiFAST™ SYBR kit (BIOLINE). The primer sequences used for qPCR are listed in Table S1 ...
-
bioRxiv - Immunology 2023Quote: ... RNA was isolated using ISOLATE II RNA Mini Kit (Bioline) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... qPCR was performed using the SensiFAST SYBR NoROX Kit (Bioline) supplemented with 0.2μM of specific primer pairs (Table S9 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Reactions were performed with SensiFAST SYBR Hi-ROX kit (Bioline), and all samples and negative controls were run in technical duplicate on an Applied Bioscience StepOnePlus qPCR machine (Life Technologies).
-
bioRxiv - Cell Biology 2023Quote: ... and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline). Gene expression was measured using qRT-PCR using TaqMan (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline). Gene expression was measured using qRT-PCR using TaqMan (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was isolated using Isolate II RNA Mini Kit (Bioline) and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline) ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA was generated using the Tetro cDNA Synthesis Kit (Bioline) and the Uni12 primer (5’-AGCAAAAGCAGG-3’ ...
-
bioRxiv - Neuroscience 2023Quote: ... and reverse transcribed using the SensiFast cDNA Synthesis Kit (Bioline). Quantitative real-time PCR was performed in triplets for each sample using the LightCycler DNA Master SYBR Green I Kit in a LightCycler 480 System (Roche) ...
-
bioRxiv - Cell Biology 2023Quote: ... and cDNA was synthesized using a SensiFast cDNA kit (Bioline) using manufacturer’s instructions from 250 ng of RNA ...
-
bioRxiv - Developmental Biology 2024Quote: ... using the Sensifast SYBR no Rox kit (Bioline, BIO-98020). Data analysis and visualisation was performed using Microsoft Excel (Office 365 ...
-
bioRxiv - Cell Biology 2020Quote: ... qPCR was performed using the SensiFAST SYBR No-ROX Kit (Bioline). Primers used to quantify FLOE1 expression were priqPCRFLOE1set1-FWD/REV (Table S3) ...
-
bioRxiv - Immunology 2021Quote: ... Real-time RT-PCR using SensiFast SYBR No-Rox kit (Bioline) was performed to determine gene expression ...
-
bioRxiv - Genetics 2021Quote: ... cDNA was synthesized using the SensiFast cDNA synthesis kit (Bioline, USA), and qPCR was done using the SYBR green mix (Bio-Rad ...
-
bioRxiv - Genetics 2021Quote: ... cDNA was synthesized using the SensiFast cDNA synthesis kit (Bioline, USA), and qPCR was done using the SYBR green mix (Bio-Rad ...
-
bioRxiv - Developmental Biology 2021Quote: RNA was isolated using the ISOLATE II RNA Mini Kit (Bioline) following manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2020Quote: ... The SensiMix SYBR No-ROX kit was from Bioline (London, UK). SmaI was from New England Biolabs (Ipswich ...
-
bioRxiv - Molecular Biology 2021Quote: ... a SensiFAST™ SYBR® No-ROX Kit (Bioline, London, UK) was used to perform the qPCR ...
-
bioRxiv - Molecular Biology 2021Quote: qPCRs were performed using SensiFastTM SYBR® Lo-ROX kit (Bioline). A master mix for each primer pair was prepared following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... and column purified using ISOLATE II RNA Mini Kit (Bioline, Australia) according to the manufacturer’s instruction ...
-
bioRxiv - Immunology 2020Quote: RNA was isolated using the ISOLATE II RNA Mini Kit (Bioline) following the manufacturer’s guidelines ...
-
bioRxiv - Cancer Biology 2019Quote: ... Synthesis of cDNA was performed using Sensifast cDNA Synthesis Kit (Bioline) according to the manufacturer’s instructions ...
-
Virus-mediated transient expression techniques enable genetic modification of Alopecurus myosuroidesbioRxiv - Genetics 2020Quote: ... or Isolate II PCR and Gel Kit (Bioline cat# BIO-52059) according to the manufacturer’s protocols ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... with a MyTaq HS Red Mix PCR kit (Bioline, Eveleigh, Australia). Each 20 μL reaction contained 5 μL of MilliQ water ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was reverse transcribed with the Tetro cDNA synthesis kit (Bioline) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 5 μl of 2X SensiFAST SYBR No-ROX kit (Bioline) in a 10 μl total volume ...
-
bioRxiv - Microbiology 2021Quote: ... Real-time PCR was performed using SensiFAST SYBR & Fluorescein Kit (Bioline) as previously described (25,32) ...
-
bioRxiv - Microbiology 2019Quote: ... with the SensiFAST™ SYBR® No-ROX Kit (Bioline, USA). Reaction mix composition was ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR was performed using SensiFast SYBR Hi-ROX qPCR kit (BioLine). rp49 was used as a housekeeping gene for ΔΔCt calculations ...
-
bioRxiv - Developmental Biology 2020Quote: Total RNA was isolated using Isolate II RNA Mini Kit (Bioline). cDNA was synthesized using SensiFAST cDNA Synthesis Kit (Bioline) ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA synthesis was performed using the Tetro cDNA synthesis kit (Bioline). 2x GoTaq Green master mix (Promega ...
-
bioRxiv - Plant Biology 2021Quote: ... and SensiMix™ SYBR® & Fluorescein Kit (Bioline, Catalog # QT615-05) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... and DNA purification and plasmid isolation kits were obtained from Bioline (Cat#BIO-52060 and Cat#BIO-52057 ...
-
bioRxiv - Microbiology 2019Quote: ... The SensiFAST SYBR Hi-ROX kit (Bioline United Kingdom, BIO-92020) and custom gene-specific primer sets were used to assay 20 ng DNA per reaction for HCMV gB (UL55 ...
-
bioRxiv - Microbiology 2019Quote: ... A SensiFAST Probe No-ROX One-Step Kit (Bioline, NSW, Australia) was used to carry out the gene expression study following the manufacture’s protocol with a Rotor-gene Q Instrument (Qiagen ...
-
bioRxiv - Plant Biology 2020Quote: ... amplification was performed using SensiFAST™ SYBR® & Fluorescein Kit (Bioline) and iQ5 Biorad system ...
-
Increased ACTL6A Occupancy Within mSWI/SNF Chromatin Remodelers Drives Human Squamous Cell CarcinomabioRxiv - Molecular Biology 2021Quote: ... complementary DNA was further synthesized using SensiFAST cDNA synthesis kit (Bioline). cDNAs were mixed with indicated primers and SensiFAST SYBR lo-ROX reagents (Bioline) ...
-
bioRxiv - Neuroscience 2020Quote: ... and cDNA synthesis was performed using Tetro cDNA synthesis kit (Bioline). qPCR was carried out on an Applied Biosystems 7900HT Fast Real-Time PCR system using the SYBR Green method using 1 μl cDNA per triplicate ...
-
bioRxiv - Microbiology 2020Quote: ... in 20μl reactions using the SensiFAST Probe Hi-ROX Kit (Bioline) (cycling conditions ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA was reverse transcribed using the SensiFAST cDNA Synthesis Kit (Bioline) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... or the using Bioline Isolate II Genomic DNA extraction kit (Bioline) following the manufacturer’s protocol and suspended in 50 μL elution buffer ...
-
bioRxiv - Developmental Biology 2020Quote: ... qRT-PCR was performed using SensiMix SYBR low-ROX kit (Bioline) on a QuantStudio5 machine (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2020Quote: ... qPCR was performed using SensiFAST™ SYBR Hi-ROX Kit (Bioline). rp49 was used as a housekeeping gene for ΔCt calculations ...