Labshake search
Citations for Bioline :
1 - 50 of 795 citations for Human V Set And Immunoglobulin Domain Containing Protein 2 VSIG2 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... qPCR reactions were set up using SensiFast 2× Mastermix (Bioline Cat# BIO-94020) and oligonucleotides targeting genes of interest (IDT ...
-
bioRxiv - Molecular Biology 2021Quote: ... qPCR reactions were set up using sensiFAST SYBR Lo-ROX kit (Bioline). The qPCR was performed as described above for RIP-qPCR.
-
bioRxiv - Immunology 2019Quote: ... Quantitative-PCR was set up using the SensiFAST SYBR Hi-ROX kit (Bioline) on a StepONE system (Applied Biosytems) ...
-
bioRxiv - Plant Biology 2020Quote: ... The digested product was visualized on a 2% (w/v) agarose gel (Bioline) by electrophoresis at 90 V for 90 min and the genotype of each line at the SNP position was confirmed according to the product bands on the gel ...
-
bioRxiv - Genetics 2023Quote: ... The RT-qPCR reactions were set up using SensiFAST SYBR No-ROX kit (Bioline, BIO-98005) in a Light Cycler 480 II system (Roche) ...
-
bioRxiv - Immunology 2023Quote: ... the aqueous phase was mixed 1:1 v/v with 70% ethanol and loaded into a column of the Isolate II RNA Mini kit (Bioline, Cincinnati, OH). Total RNA was purified following the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2021Quote: ... a 10 μl qPCR reaction is set up using SensiFAST SYBR No-ROX kit (FroggaBio/Bioline, catalogue number BIO-98050), forward and reverse primers (Table 2) ...
-
bioRxiv - Neuroscience 2020Quote: ... RT-PCR reactions were set up in a 384-well format using 2X SensiFAST Probe No-ROX Kit (Bioline, BIO-86005) and 1 µl of cDNA per reaction in a total volume of 10 µl ...
-
bioRxiv - Cell Biology 2019Quote: ... The cDNA was then diluted 1:5 and qRT-PCR reactions were set up in triplicate using primers synthesized from IDT and SensiMix SYBR & Fluorescin kit (Bioline, Meridian Bioscience). qRT-PCR was done using a Corbett Research RG 6000 thermocycler ...
-
bioRxiv - Microbiology 2020Quote: ... containing 1X of SensiFast SYBR Lo-ROX kit (Bioline, Meridian Biosciences, Memphis, TN), 400 nM sense and antisense primers and between 150 to 400 ng of DNA ...
-
bioRxiv - Molecular Biology 2019Quote: ... qRT-PCR was carried out with specific primer sets (listed in Supplementary Table 10) using SensiFAST™ SYBR® No-ROX Kit (BIOLINE, BIO-98005) and CFX Connect Real-Time PCR Detection System (BIO-RAD ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Reactions were performed in a total volume of 25 μl containing 12.5 μl 2 x MyTaq Red (Bioline, UK), 0.5 μl of each 10 μM primer stock ...
-
bioRxiv - Cancer Biology 2020Quote: ... The PCR reaction containing SensiMix™ SYBR Green® No-ROX Kit (QT650-20, Bioline) was run on a 7900 Real time PCR System (Applied Biosystems ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was extracted using the ISOLATE II RNA/DNA/Protein kit (Bioline, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: RNA was isolated using Bioline II DNA/RNA/Protein extraction kit (Bioline, Australia) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... qPCR reactions were set up using SensiMix 2x Mastermix (Bioline Cat# QT615-20) and oligonucleotides targeting genes of interest (IDT ...
-
bioRxiv - Microbiology 2019Quote: Plasmodium screening of human subjects was done in the regions surrounding Mbita using RDT kits (SD Bioline, UK). Microscopy was carried out on RDT-positive samples to confirm the presence of P ...
-
bioRxiv - Cell Biology 2021Quote: ... The interaction between the protein products fused to the DNA binding and activation domains were analyzed by the activity of β-galactosidase by the cleavage of X-Gal (BIO-37035, Bioline, UK). For detecting the β-galactosidase activity overlaying of low melting agarose with X-Gal (over lay mix was prepared freshly) ...
-
bioRxiv - Microbiology 2019Quote: ... each PCR assay was set-up with nuclease-free water as the negative control (Bioline, UK), and positive controls were not included due to financial constraints ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL 1:1 diluted cDNA and SensiFAST SYBR No-ROX Kit (#BIO-98005, Bioline). Knockdown was assessed using ΔΔCt analysis as described by Pfaffl [92].
-
bioRxiv - Microbiology 2019Quote: ... with total reaction volume of 10 μl containing 5 μl Rotor-Gene SYBR® Green PCR Kit (Bioline, Australia), 0.3 μl each of 10 μM forward and reverse primer and 2 μl of genomic DNA ...
-
bioRxiv - Microbiology 2020Quote: ... Human genomic DNA purchased from Bioline Australia (Cat No ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 µg of total RNA was used to prepare cDNA with SensiFast cDNA synthesis kit (Bioline) according to the manufacturer’s instructions and diluted 1:6 with DNAse/RNAse-free water (Thermo Fisher ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 RNA was converted to cDNA using the SensiFAST cDNA kit (#BIO-65053, BioLine) with 10 μL of RNA extract per reaction following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... 2 μL was used as a template in 20 μL qPCR reactions containing 10 μL SensiFAST™ Probe Hi-ROX (Bioline, Cat. No. BIO-82020), 200 nM probe ...
-
bioRxiv - Immunology 2021Quote: ... The master mix was prepared with 2.5 mL of 2X buffer containing Taq-polymerase was prepared from the TaqMan RT-PCR kit (Bioline #BIO-78005). From the kit ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative real-time PCR reactions were performed with different sets of primers and Sensifast SYBR (Bioline, Taunton, MA) on a CFX96 or CFX384 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Microbiology 2024Quote: ... 1 ng/μl of total DNA was amplified using the primer sets in SensiFAST SYBR No-ROX (Bioline). qPCR was realized in technical duplicates in the Rotor-Gene Q real-time PCR cycler (Qiagen) ...
-
bioRxiv - Biochemistry 2020Quote: ... 2’dUTP and 2’dCTP were from Bioline Reagents (London ...
-
bioRxiv - Plant Biology 2020Quote: ... First-strand cDNA was made from 2 μg of RNA using the Tetro cDNA synthesis kit with DNase treatment according to manufacturer’s instructions (Bioline). cDNA was diluted 1 to 5 into RNAse free water to a total of 100 μl ...
-
bioRxiv - Microbiology 2020Quote: ... 1 ng human genomic DNA (Bioline, Cat. # BIO-35025) was used as negative control ...
-
bioRxiv - Plant Biology 2020Quote: ... The PCR product was visualized on a 1% (w/v) agarose gel (Bioline) by electrophoresis at 90 V for 1 h and the 1.5 kb target band was collected for purification using NucleoSpin® Gel and PCR Clean-up kit (Macherey-Nagel ...
-
bioRxiv - Immunology 2022Quote: ... Complementary DNA was synthesized using 2 µg of RNA and the Tetro cDNA synthesis kit (Bioline Reagents Ltd., London, UK) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... qPCRs were run using 2 µl cDNA (diluted 1:1) in a 10 µl reaction with 5 µl SensiFAST SBYR No-ROX Kit (Bioline) and 0.1 µM of each primer ...
-
bioRxiv - Immunology 2021Quote: ... Complementary DNA was synthesized using 2 μg of RNA and the Tetro cDNA synthesis kit (Bioline Reagents Ltd., London, UK) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... 1 μg of the entry vector was also digested with EcoRI-HF and NheI-HF and the linearised product was purified from a 2% agarose gel using PCR Isolate II PCR and Gel Kit (Bioline). The digested and purified reporter pool was then ligated into 80 ng of the linearised entry vector using Takara ligation kit v1.0 (#6021 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... qRT-PCR was carried out on 1:2 diluted cDNA on an Applied Biosystems StepOnePlus system using a Sensifast Hi-Rox SYBR kit (Bioline). Cycle conditions were as follows ...
-
bioRxiv - Microbiology 2023Quote: ... The reactions (10 μL total volume) contained 5 μL of 2 × SensiFAST™ SYBR No-ROX Kit (Bioline, London, UK), 0.2 μM of each arsM gene primer ...
-
bioRxiv - Microbiology 2021Quote: ... containing 12.5 μL MyFiTM Mix (Bioline, London, UK), 9.3 μL water ...
-
bioRxiv - Molecular Biology 2024Quote: ... containing 0.16 U/μl Ribosafe RNase inhibitors (Bioline), 2 mM PMSF and cOmplete™ EDTA-free Protease Inhibitor Cocktail and lysed for 10 min on ice before refrigerated centrifugation at 17,000g for 5 min ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... and real-time qPCR using primer sets (CYP1A1: CAACCCTTCCCTGAATGCCT and GCTTCTCCTGACAGTGCTCA; CYP1B1: AACGTACCGGCCACTATCAC and TCACCCATACAAGGCAGACG) and 2x SensiMix SYBR & Fluorescein Mastermix (Bioline QT615-05) on the iCycler (Bio-Rad).
-
bioRxiv - Plant Biology 2020Quote: ... The final PCR products were visualized on a 1% (w/v) agarose gel (Bioline) by electrophoresis at 90 V for 1 h ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The gel contained 1.95 g of agarose powder (Bioline, final concentration 1.3% w/v) in 150 mL of 0.5 x TBE buffer (50 mM Tris ...
-
bioRxiv - Genetics 2020Quote: Separation of the amplified product was accomplished in a 4% (w/v) agarose (Bioline, London) gel in 1% (w/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... was amplified in 10 μL reactions containing 2x SensiMix (Bioline) and 1 μM of forward and reverse primers ...
-
bioRxiv - Microbiology 2019Quote: ... containing 50 μl of 2x PCR BioMix™ (Bioline, London, UK), 1 ul (5 pmol ...
-
bioRxiv - Microbiology 2019Quote: ... containing 50 μl of 2x PCR BioMix™ (Bioline, London, UK), 5 pmol of both forward and reverse primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... containing 12.5 µl of 2X BioMix PCR master mix (Bioline, UK), 0.75 µl of 0.3 µM forward and reverse primer (Invitrogen ...
-
bioRxiv - Neuroscience 2019Quote: A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... The amplification was performed in 25 µl containing Biomix reaction mix (Bioline) and ultra-stable Taq DNA polymerase (Bioline) ...