Labshake search
Citations for Bioline :
401 - 450 of 883 citations for Human Single stranded DNA binding protein 4 SSBP4 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... or the ISOLATE II RNA Plant kit (Bioline, Meridian Life Science). RNA integrity was confirmed by either agarose gel electrophoresis or by capillary electrophoresis in an Agilent 2100 Bioanalyzer according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries of cDNA were created using SensiFAST cDNA Synthesis Kit (Bioline). Control reactions without reverse transcriptase were conducted to confirm the absence of contaminating DNA in all samples ...
-
bioRxiv - Immunology 2021Quote: ... obtained from the TaqMan RT-PCR kit (Bioline cat# BIO-78005), RT ...
-
bioRxiv - Cell Biology 2022Quote: ... employing SYBR Green chemistry (SensiMix™ SYBR® & Fluorescein Kit, Bioline). PCR reactions contained 2.0 μL diluted cDNA sample (corresponding to 7.5 ng total RNA ...
-
bioRxiv - Immunology 2022Quote: ... obtained from the TaqMan RT-PCR kit (Bioline cat# BIO-78005), was added to a 15 mL tube ...
-
bioRxiv - Molecular Biology 2022Quote: ... RT-qPCR was performed using SensiFAST SYBR No-ROX Kit (Bioline) and 0.3 μM of forward and reverse primers ...
-
bioRxiv - Plant Biology 2022Quote: ... patens cDNA was synthesised using the Tetro cDNA synthesis kit (Bioline) with OligodT primers as per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... RT-qPCR was conducted with SensiFast SYBR lo- ROX Kit (Bioline) on a Quant Studio 6 Flex real-time PCR system (Thermo Fisher Scientific).
-
bioRxiv - Genomics 2023Quote: ... PCR products purified with Isolate II PCR and Gel Kit (BIOLINE) and cloned into the entry vector pCR®8/GW/TOPO (#250020 Invitrogen ...
-
bioRxiv - Genomics 2023Quote: ... Quantitative PCRs were performed using the SensiFAST SYBR NoROX Kit (Bioline) and analyzed on a light cycler rapid thermal system (LightCycler®480 2.0 Real time PCR system ...
-
bioRxiv - Microbiology 2023Quote: ... 0.5 µl of 2X Mix SensiFast Sybr NO-ROX Kit (Bioline), and 2.8µl of sterile molecular biology grade water (Hyclone Hypure ...
-
bioRxiv - Cell Biology 2023Quote: ... qPCR was performed using 2x SensiFAST SYBR No-ROX kit (Bioline) in 20 µl reactions using 1µl of RT reaction as input and 0.4µM each primer.
-
bioRxiv - Plant Biology 2023Quote: ... purified and converted to cDNA with sensiFAST cDNA Synthesis Kit (Bioline), using the provided mix of random hexamers and anchored oligo dT primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli (TOP10- or Stbl3) using Isolate II plasmid miniprep kit (Bioline).
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was synthesized using Sensifast cDNA synthesis kit (Bioline, BIO-65054). Quantitative real-time PCR (qPCR ...
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA was reverse transcribed with SensiFAST cDNA Synthesis Kit (Bioline) according to the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2024Quote: ... cDNA was synthesized using SensiFASTTM cDNA Synthesis Kit (BioLine; BIO-65053) and following all protocol specifications from the vendor ...
-
bioRxiv - Developmental Biology 2021Quote: ... For methylated DNA amplification by PCR each one of these products was mixed with 118 μl of DamID PCR buffer and 2 μl (10 units) of MyTaq™ DNA polymerase (Bioline) and were aliquoted at 40 μl in 4 different 0.2 ml PCR tubes ...
-
bioRxiv - Zoology 2022Quote: We set up 50 μl PCR reactions using 2.5 μl template DNA and 47.5 μl PCR mastermix made from 5 μl of 10× OptiBuffer (Bioline Reagents Ltd, UK), 2.5 μl of primer at 10 μM ...
-
bioRxiv - Neuroscience 2021Quote: ... We synthesized complementary DNA (cDNA) from 100ng of RNA in a 40μl reaction containing 100 units of Tetro Reverse transcriptase (Bioline, Taunton, MA), 8μl of 5X RT buffer ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The DNA was used as template for PCR amplification of the targeted sites with primers listed on Supplementary Table 3 and using MyTaq™ DNA Polymerase (Bioline). Subsequently ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Converted DNA was subjected to 12 cycles of PCR amplification to enrich for adapter-ligated fragments with MyTaq Mix (Bioline Inc.), during which each sample was also barcoded with unique sequence tags ...
-
bioRxiv - Molecular Biology 2023Quote: ... expanded and initially screened for correct integration using homology- arm spanning PCRs (Immolase DNA polymerase, Bioline, supplemented with Q solution, Qiagen). Genotypes of positive clones were confirmed by Sanger sequencing ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... We synthesized complementary DNA (cDNA) from 100 ng of RNA in a 40µl reaction containing 100 units of Tetro Reverse transcriptase (Bioline, Taunton, MA), 8µl of 5X RT buffer ...
-
bioRxiv - Plant Biology 2022Quote: ... and amplified with primers CUE8cDNA-F (CACCATGGCTAACGAAGAACTCAC) and CUE8cDNA-STOP-R (AGAGACTCAAGACACAGCAGGA) using BIO-X-ACT Long DNA polymerase (Bioline, London, UK). The 2622 bp product was directionally cloned by ligation into the pENTR/D-TOPO vector (Invitrogen/Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... 458/459/JL-D2) in TBE (Tris, boric acid, ethylenediaminetetraacetic acid) and product size approximated using HyperLadderII 50bp DNA marker (Bioline, Sydney, Australia).
-
bioRxiv - Microbiology 2020Quote: All PCRs were carried out in 25 μl reaction volumes containing 0.05 units of MyTaq™ DNA Polymerase (Bioline Laboratories, London, UK), 1x MyTaq™ Mix (Bioline ...
-
bioRxiv - Neuroscience 2022Quote: ... a first-round PCR was carried out using 200 ng of template cDNA with My Taq DNA polymerase (Bioline Alexandria, NSW, Australia), initial denaturation at 95°C for 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... SdhC and SdhD was performed with primers listed in Table 2 and the following reaction conditions: PCR amplification used MyTaq DNA Polymerase (Bioline, London, UK), with 0.25 μM each forward and reverse primer ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell were propogated in either LB or TB media and protein expression was performed by inducing with 0.5 mM IPTG (Isopropyl ß-D-1-thiogalactopyranoside, Bioline, Cat No. BIO-37036) overnight at 180C ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA extraction was performed using the Isolate II RNA Plant kit (Bioline). During RNA extraction two samples were combined by using the same lysis buffer on two samples to make up one biological replicate ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was isolated using an Isolate II Rna Mini Kit (Bioline). 250~500 ng of RNA was reverse transcribed into cDNA using the High-Capacity cDNA reverse transcription kit (Applied Biosystems) ...
-
bioRxiv - Immunology 2021Quote: ... which was conducted using the SensiFAST SYBR No-ROX Kit (Bioline, Singapore) on the QuantStudio 5 or QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific) ...
-
bioRxiv - Genetics 2021Quote: ... RNA was isolated from tissue samples using Isolate RNA mini kit (Bioline) and cDNA was prepared with Tetro cDNA Synthesis kit (Bioline) ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was reverse transcribed to cDNA using SensiFAST cDNA synthesis kit (Bioline). The cDNA was diluted 1:5 with nuclease free water and 5 μL were used per qPCR reaction ...
-
bioRxiv - Molecular Biology 2021Quote: ... qPCR reactions were set up using sensiFAST SYBR Lo-ROX kit (Bioline). The qPCR was performed as described above for RIP-qPCR.
-
bioRxiv - Immunology 2019Quote: ... qPCR was then performed using the SensiFAST SYBR Hi-Rox kit (Bioline) and a StepOnePlus real-time PCR instrument (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2019Quote: ... Resulting cDNA was amplified with the SensiFAST Probe Hi-ROX Kit (Bioline). The fold change in expression were calculated by the ΔΔCT method using snoRNA202 and U6 RNA as reference small RNAs in mouse and human cells ...
-
bioRxiv - Developmental Biology 2020Quote: ... cDNA was transcribed using 1µg RNA and sensiFAST cDNA Synthesis Kit (Bioline) following the instructions of the manufacturer.
-
bioRxiv - Microbiology 2019Quote: ... cDNA samples were used for qPCR (Bioline SensiFAST SYBR and Flourescein kit) in technical triplicates on a Roche Lightcycler 96 as described previously (53) ...
-
bioRxiv - Microbiology 2019Quote: ... and RNA was reverse-transcribed into cDNA (Bioline Tetro cDNA synthesis kit). cDNA samples were used for qPCR (Bioline SensiFAST SYBR and Flourescein kit ...
-
bioRxiv - Biochemistry 2020Quote: ... cDNA synthesis was carried out using SensiFAST cDNA Synthesis Kit from BIOLINE. Quantitation of all gene transcripts was done by qPCR using SYBR Green (Applied Biosystems ...
-
bioRxiv - Plant Biology 2020Quote: ... First-strand cDNA was synthesized with the SensiFAST Kit (Bioline, Alexandria, Australia). Fluorescence reflecting target genes expression was determined by the SensiFAST SYBR No-ROX Kit (Bioline ...
-
bioRxiv - Biochemistry 2021Quote: ... total cellular RNA was isolated using the Isolate II RNA kit (Bioline) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... Quantitative PCR was performed using the SensiFAST SYBR Hi-ROX kit (Bioline) and an AriaMX Real Time PCR system (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and purified using the PCR Isolate II PCR and Gel Kit (Bioline) or by ExoSAP (for primers see Table S4) ...
-
bioRxiv - Cell Biology 2021Quote: RNA was extracted using the Isolate II RNA Mini kit (Bioline, UK). 1-3 µg were reverse transcribed with a MuLV reverse transcriptase (Applied Biosystems ...
-
bioRxiv - Cell Biology 2021Quote: ... and cDNA was synthesised with SensiFast cDNA synthesis kit (Bioline, London, UK) according to the manufacturers’ protocols ...
-
bioRxiv - Cell Biology 2020Quote: ... Quantitative PCR was performed with the SensiFAST SYBR Hi-ROX Kit (Bioline) using a StepOnePlus 96-well plate reader (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2020Quote: ... total RNA was isolated using an Isolate II RNA Mini Kit (Bioline) directly from the wells as per manufacturer’s instructions ...