Labshake search
Citations for Bioline :
1 - 50 of 248 citations for Human PDGF alpha receptor PDGFRA qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... 0.4 μL 10 μM specific primer pairs (mixture of forward and reverse primers) was mixed with 10 μL SensiFAST SYBR (Bioline) mastermix and 9.6 μL of cDNA ...
-
bioRxiv - Genetics 2024Quote: ... Each combination of DNA sample and primer pair was amplified using 5ul BioMix Red (Bioline), 0.5ul forward primer ...
-
bioRxiv - Molecular Biology 2021Quote: ... 8 µl of primer pairs (0.5 µM each) and 10 µl of SensiMix SYBR & fluorescein mastermix (Bioline). The protocol included a 10 minute step at 95°C followed by 40 cycles at 95°C for 10 s and 60°C for 15 s ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we used the primer pairs desatF_for/desatF_rev (Tm = 60) and eloF_for/eloF_rev (Tm = 62) with MyTaq Red (Bioline, Meridian Bioscience) to distinguish between D ...
-
bioRxiv - Genomics 2023Quote: ... final libraries were quantified by qPCR comparison to previously-sequenced NGS libraries using Illumina P5/P7 qPCR primers and SensiMix SYBR (Bioline).
-
bioRxiv - Evolutionary Biology 2020Quote: ... Quantitative PCR was carried out using CTS gene specific primer pairs (Supplemental Data 8) with SYBR green-based visualization of product amplification (Bioline). Changes in CTS gene transcript levels relative to Actin (ACT1 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We labeled each library with a sample-specific pair of barcodes and combined libraries in equimolar ratios based on qPCR using SensiFAST SYBR Hi-ROX master mix (Bioline), then sequenced the combined pools on four lanes of 50bp single end reads (Illumina HiSeq2500 ...
-
bioRxiv - Microbiology 2021Quote: ... the K13 locus was amplified directly from whole blood using the primer pair p26+p27 (Table S9) and the MyTaq™ Blood-PCR Kit (Bioline). Primer pairs p39+p40 and p50+p51 were used to amplify fd and mdr2 ...
-
bioRxiv - Physiology 2021Quote: ... the K13 locus was amplified directly from whole blood using the primer pair p26+p27 (Supplementary file 5) and the MyTaq™ Blood-PCR Kit (Bioline). Primer pairs p39+p40 and p50+p51 were used to amplify fd and mdr2 ...
-
bioRxiv - Microbiology 2024Quote: ... coli (alpha-select competent cells, Bioline) and plasmids were purified using GeneJET Plasmid Miniprep Kit (ThermoFisher) ...
-
bioRxiv - Neuroscience 2023Quote: Human samples: qPCR experiments were conducted using the SensiFAST Probe Hi-ROX Master Mix (Bioline) and the TaqMan Gene Expression Assays (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2021Quote: ... and qPCR reactions were conducted using gene-specific primers with SensiFAST SYBR No-ROX kit (Bioline, #Cat no: BIO-98005) as described previously (Sibai et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... Enrichment of ChIP DNA at predicted sites for each chromatin modification was confirmed by qPCR using primers given in the Key Resources Table and SensiMix SYBR (Bioline, UK). 25 – 100 ng of ChIP DNA was used for library prep using the NEBNext Ultra II DNA Library Prep Kit with NEBNext Single indices (E7645).
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... and real-time qPCR using primer sets (CYP1A1: CAACCCTTCCCTGAATGCCT and GCTTCTCCTGACAGTGCTCA; CYP1B1: AACGTACCGGCCACTATCAC and TCACCCATACAAGGCAGACG) and 2x SensiMix SYBR & Fluorescein Mastermix (Bioline QT615-05) on the iCycler (Bio-Rad).
-
bioRxiv - Cell Biology 2021Quote: ... qPCR was performed using SensiFast SYBR Hi-ROX qPCR kit (BioLine). rp49 was used as a housekeeping gene for ΔΔCt calculations ...
-
bioRxiv - Cell Biology 2024Quote: ... qPCR was performed using sensiFAST SYBR No ROX qPCR kit (Bioline) and a CFX96 Real-Time PCR system (Biorad) ...
-
bioRxiv - Genomics 2021Quote: ... qPCR amplification was performed in triplicate with SYBR green qPCR chemistry (Bioline) using primers for Tnfa (F-5’- ACCTCACACTCAGATCATCTTCTC-3’ ...
-
bioRxiv - Molecular Biology 2020Quote: ... using Random Primer (Bioline Inc.) by incubating the reaction mixture at 50°C for 30 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... using random primers (Bioline, UK). One µl of cDNA was specifically and quantitatively amplified using Biotool 2x SybrGreen qPCR master mix (Stratech ...
-
bioRxiv - Molecular Biology 2022Quote: ... using Random Primer (Bioline Inc.) by incubating the reaction mixture at 50°C for 30 minutes ...
-
bioRxiv - Plant Biology 2022Quote: ... and the qPCR SensiMix kit (BioLine, GC Biotech BV ...
-
bioRxiv - Microbiology 2021Quote: ... using SYBR Green qPCR mix (Bioline) on a LightCycler 480 instrument (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... This cDNA library was then PCR barcoded with PCR Primer 1.0 (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG-3’) and a sample-specific barcode primer (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTG-3’) using MyTaq Red Mix (Bioline) for 15 cycles ...
-
bioRxiv - Genetics 2023Quote: ... An 800–base pair region surrounding the target site of the Cypor sgRNA was amplified (forward primer 5′-GTTTGCGGGTGTTAGCTCTTC-3′; reverse primer 5′-TTGGTGGGTAAATCACACCGT-3′) using MyTaq Red Mix (Bioline). The amplicon was purified using the PCR clean-up and gel extraction kit (Macherey-Nagel ...
-
bioRxiv - Cancer Biology 2021Quote: ... and oligo (dT)18 primers (Bioline #BIO-38029). The RT-qPCR reaction was performed using SensiFAST SYBR Hi-ROX Kit (Bioline #BIO-92020 ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR was set up for each primer set and each primer concentration with the SYBR Hi-ROX Sensimix (Bioline Cat: QT60505) along with melt curve data to check for primer specificity ...
-
bioRxiv - Microbiology 2020Quote: ... Primers used in this analysis were obtained from Bioline Inc (Taunton ...
-
bioRxiv - Molecular Biology 2020Quote: ... random hexamers primers and Tetro cDNA synthesis kit (Bioline) were used for cDNA synthesis and GAPDH was used as internal control ...
-
bioRxiv - Genetics 2021Quote: ... qPCR was conducted with SensiMix SYBR Green (Bioline) on the StepOne Plus (Life Technologies ...
-
bioRxiv - Developmental Biology 2020Quote: ... qPCR was performed with SensiFast Sybr green (BIOLINE). For each genotype ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by qPCR using SensiMix SYBR (Bioline, UK) and KAPA Illumina DNA standards (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The final product was diluted to 1:20 and 2 µL of the dilution were used in each 10-µl RT-qPCR reaction along with 400 nM of primers gene- or isoform-specific primers (Table S4B) and 1X SensiFAST SYBR No-ROX Mix (Bioline, cat#BIO-98005). Quantitative PCR was performed in CFX384 Touch Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Genetics 2022Quote: ... qPCR reactions comprised 1X SYBR Green No-Rox (Bioline), 250 nM forward and reverse primers (Supplementary Table 1) ...
-
bioRxiv - Neuroscience 2021Quote: ... the PyroTaq EvaGreen qPCR Master mix (Cultek Molecular Bioline) and the following primers (Sigma ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by qPCR quantification using SensiMix SYBR (Bioline, UK) and KAPA Illumina DNA standards (Roche) ...
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR was performed by using MyTaq HS Mix (BioLine) contain SYBR Green on a Mastercycler®ep Realplex PCR thermal cycler machine (Eppendorf) ...
-
bioRxiv - Plant Biology 2021Quote: ... RT-qPCR reactions using SYBR green chemistry (SensiFast; Bioline) were set up with a CAS-1200N robotic liquid handling system (Corbett Research ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by qPCR using SensiMix SYBR Green mastermix (Bioline) and KAPA Illumina DNA standards (Roche) ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by qPCR quantification using SensiMix SYBR (Bioline, UK) and KAPA Illumina DNA standards (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... qPCR was conducted using SensiFast Sybergreen Mastermix (Bioline, USA) using a pair of primers specific to KLHL24 with annealing temperature of 53°C ...
-
bioRxiv - Immunology 2021Quote: ... and assessed by qPCR (SensiMix SYBR Hi-Rox, Bioline). Expression levels of each gene were normalized against GAPDH expression and fold change was calculated using the 2-ΔCT or 2-ΔΔCT equations [54] ...
-
bioRxiv - Immunology 2020Quote: ... and qPCR performed according to the manufacturer’s instruction (Bioline). All primers (Merck ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR was performed using SensiFast SYBR Hi-ROX kit (Bioline) on CFX96 Touch Real-Time PCR System (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... For RT-qPCR the SensiFAST SYBR Lo-ROX Kit (Bioline) was used ...
-
bioRxiv - Cancer Biology 2020Quote: ... qPCRs were run using SensiFAST SYBR No-ROX Kit (Bioline) and a Roche LightCycler 384 ...
-
bioRxiv - Plant Biology 2021Quote: ... RT-qPCR reactions were made using SensiFAST master-mix (Bioline), in 20 μl volumes ...
-
bioRxiv - Microbiology 2021Quote: ... with Sensi-FAST Probe Hi-ROX qPCR kit (Bioline, 82005) (8).
-
bioRxiv - Genomics 2023Quote: ... qPCR was performed using the SensiFAST SYBR NoROX Kit (Bioline) supplemented with 0.2μM of specific primer pairs (Table S9 ...
-
bioRxiv - Molecular Biology 2024Quote: ... qPCR was performed in triplicate using SensiMix SYBR (Bioline #QT65005) and 10 µM each of forward and reverse primers (listed in Supplemental information ...
-
bioRxiv - Cancer Biology 2024Quote: ... qPCR was performed using SensiFast SYBR Hi-ROX kit (Bioline) on a CFX96 Touch Real-Time PCR System (Bio-Rad) ...