Labshake search
Citations for Bioline :
1 - 50 of 127 citations for Human Immunodeficiency Virus Nef Protein HIV 1 Clade B IIIB since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... individuals testing HIV negative by rapid immunoassays (SD Bioline HIV1/2 Elisa 3.0 ...
-
bioRxiv - Microbiology 2020Quote: ... 1 ng human genomic DNA (Bioline, Cat. # BIO-35025) was used as negative control ...
-
bioRxiv - Microbiology 2020Quote: ... Human genomic DNA purchased from Bioline Australia (Cat No ...
-
bioRxiv - Neuroscience 2019Quote: A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...
-
bioRxiv - Physiology 2021Quote: ... was performed with three primers (Figure 1 A, “a”: AAGGCGCATAACGATACCAC, “b”: TACAATGCAGGCTCCAAACAC, “c”: CGAGCACAGGAAGTTCAACA, Eurofins Genomics, Ebersberg/Germany) and the ImmoMix™ kit (Bioline, Cat. No BIO-25020) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2023Quote: RNA was extracted from a total of 106 B cells purified from spleen or lymph nodes or 105 B cells sorted from the B:T co-cultures (72 h) using TRIsure™ (Bioline) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell were propogated in either LB or TB media and protein expression was performed by inducing with 0.5 mM IPTG (Isopropyl ß-D-1-thiogalactopyranoside, Bioline, Cat No. BIO-37036) overnight at 180C ...
-
bioRxiv - Neuroscience 2023Quote: Human samples: qPCR experiments were conducted using the SensiFAST Probe Hi-ROX Master Mix (Bioline) and the TaqMan Gene Expression Assays (Applied Biosystems ...
-
bioRxiv - Microbiology 2022Quote: ... Quantification of SFB in human tissue biopsies was performed using the MasterMix SensiFAST™ SYBR (BIOLINE) and 3 different primer sets ...
-
bioRxiv - Microbiology 2023Quote: ... both samples were subjected to PCR with human GAPDH-specific primers41 and MyTaq polymerase (Bioline, Taunton, MA). Resulting PCR amplicons were visualized by agarose gel electrophoresis ...
-
bioRxiv - Molecular Biology 2020Quote: ... Recombinant proteins were produced in Escherichia coli BL21 (DE3) cells (Bioline) as described previously (LaCourse ...
-
bioRxiv - Microbiology 2019Quote: Plasmodium screening of human subjects was done in the regions surrounding Mbita using RDT kits (SD Bioline, UK). Microscopy was carried out on RDT-positive samples to confirm the presence of P ...
-
bioRxiv - Biochemistry 2022Quote: ... Protein overexpression was performed using Escherichia coli BL21 (DE3) pLysS cells (BIOLINE) in super broth supplemented with 200 μg/mL ampicillin (AMRESCO ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was extracted using the ISOLATE II RNA/DNA/Protein kit (Bioline, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: RNA was isolated using Bioline II DNA/RNA/Protein extraction kit (Bioline, Australia) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... 2 □1 water and 5□1 MyTaq™ HS Mix (Bioline). RT-PCR was performed in the following conditions ...
-
bioRxiv - Immunology 2020Quote: ... 1 ml of Trisure (Bioline) was added and mixed ...
-
bioRxiv - Microbiology 2023Quote: ... and HyperlLadder 1 kb (Bioline) was used for size determination.
-
bioRxiv - Evolutionary Biology 2023Quote: ... and 1 kb Hyperladder (Bioline). PCR products were purified using Mag-Bind RXNPurePlus beads (OMEGA Biotek ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL 1:1 diluted cDNA and SensiFAST SYBR No-ROX Kit (#BIO-98005, Bioline). Knockdown was assessed using ΔΔCt analysis as described by Pfaffl [92].
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1 mM dNTP (Bioline, Boston, MA), 250 nmol forward and reverse primers (IDT ...
-
bioRxiv - Genomics 2021Quote: ... 1 × MyTaq™ Red Mix (Bioline), 10 pmoles each primer and 0.25 μL (1.25 U ...
-
bioRxiv - Microbiology 2022Quote: ... with a 1 kb HyperLadder (Bioline) marker ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and a 1 kbp HyperLadder (Bioline). Genomic DNA extraction from new tissue samples was conducted using the MagJet gDNA kit (Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1 unit Biolase Taq (Bioline, Boston, MA), and 1 μl of template DNA ...
-
bioRxiv - Microbiology 2019Quote: ... 1 µl of 10 mM dNTP’s (BioLine), and 0.25 µl iProof (BioRad) ...
-
bioRxiv - Cell Biology 2021Quote: ... run with Hyperladder 1 DNA marker (Bioline). Selected clones were confirmed to have centrosomal localisation as expected by Airyscan confocal imaging ...
-
bioRxiv - Molecular Biology 2020Quote: ... qPCRs were run using 2 µl cDNA (diluted 1:1) in a 10 µl reaction with 5 µl SensiFAST SBYR No-ROX Kit (Bioline) and 0.1 µM of each primer ...
-
bioRxiv - Developmental Biology 2019Quote: ... PCR reactions were resolved in 1 % agarose (Bioline) gels containing 0.5 μg/ml Ethidium Bromide (Sigma ...
-
bioRxiv - Cancer Biology 2020Quote: ... DNA weight marker Hyperladder™ 1-kb (BIoline) and UltraRanger 1kb (Norgen Biotek ...
-
bioRxiv - Genomics 2023Quote: ... 1’ 72°C) by MyTaq Red mix (Bioline) using primers that add overhangs with EcoRI (MT024 ...
-
bioRxiv - Genetics 2023Quote: ... Hyperladder 50 bp or Hyperladder 1 kb (Bioline) served as DNA fragment size markers.
-
bioRxiv - Immunology 2023Quote: ... The total qPCR reaction volume was 1.5 μl and consisted of 0.5 μl of cDNA (dilution 1/12) and 1 μl of SensiFAST™ SYBR® No-ROX Kit (Bioline) containing 0.4 μM of PCR primer (Eurogenetec SA)(primer list in sup ...
-
bioRxiv - Microbiology 2019Quote: ... A second round of amplification was performed by transferring 5μl of 1:100 diluted Round 1 product into 15μl Bioline MyFi™ Mix (BIOLINE GmbH, Luckenwalde, Germany) reactions.
-
bioRxiv - Immunology 2023Quote: ... the aqueous phase was mixed 1:1 v/v with 70% ethanol and loaded into a column of the Isolate II RNA Mini kit (Bioline, Cincinnati, OH). Total RNA was purified following the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2021Quote: ... The final volume contained 1× SensiMix (Bioline, London, UK), 800 nM of each primer and 200nM of each probe and the PCR cycling conditions included an initial denaturation at 95°C for 10 minutes ...
-
bioRxiv - Genomics 2023Quote: ... Samples were compared to 1 Kb hype ladder (Bioline). The primer sequences are listed in Table S9.
-
bioRxiv - Cell Biology 2023Quote: ... and 1 unit of Taq polymerase (Bioline, Meridian Bioscience). The PCR conditions were an initial melting step of 94°C for 4 min ...
-
bioRxiv - Microbiology 2019Quote: ... The 1 kb molecular weight marker (HyperLadder IV, Bioline, UK) was used in together with the amplified products ...
-
bioRxiv - Microbiology 2020Quote: ... for 1 minute in 0.2 mL TRIsure (Bioline: BIO-38033). Homogenized tissue was brought to 1 mL volume with 0.8 mL TRIsure ...
-
bioRxiv - Genetics 2020Quote: ... and 1 Unit MyTaqTM (Bioline; Meridian Bioscience Inc., London, UK) by incubation for 2 min at 96°C ...
-
bioRxiv - Genomics 2023Quote: ... supplemented with 1:100 10 mg/mL Proteinase K (Bioline). TIDE was performed as described before (40) ...
-
bioRxiv - Microbiology 2021Quote: ... using 5 μl product with 1 μl 5X loading dye (BioLine) to verify bands of approximately 450 bp ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Molecular weight markers used were the 1 kb HyperLadder (from Bioline). T4 DNA ligase and buffer were purchased from New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... The resultant bands were compared to a 1 Kb HyperLadder (Bioline) using the expected sizes per gene region as follows ...
-
bioRxiv - Molecular Biology 2020Quote: ... buffer with 1 mg/ml Proteinase K (Bioline, Cat. No. BIO-37084) to pre-lyse the cells ...
-
bioRxiv - Microbiology 2019Quote: ... A 1 kilobase molecular-weight size marker (Hyperladder 1KB from Bioline UK) was used to confirm that the 16S ribosomal RNA hypervariable region had been isolated (supplementary material) ...
-
bioRxiv - Microbiology 2021Quote: ... 1% SDS (Sigma-Aldrich)] supplemented with 5 μL Proteinase K (20 mg mL−1; Bioline Australia) to lyse cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... supplemented with 1 mg/ml proteinase K (Bioline, cat. no. BIO-37084) by incubating them at 55 °C for at least 2 hours up to overnight ...
-
bioRxiv - Molecular Biology 2020Quote: ... or HyperLadder 1 kb (range 200 bp to 10 kb, BIO-33053, Bioline) to determine product sizes.