Labshake search
Citations for Bioline :
101 - 130 of 130 citations for Human Immunodeficiency Virus GP120 Protein HIV 1 Clade E CM244 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 2.5 µl of 1:10 diluted immunoprecipitation output was added to 7.5 µl of Sensi-FAST SYBR No-ROX (Bioline) and 400 nM of forward and reverse primers in a 15 µl final volume ...
-
bioRxiv - Neuroscience 2022Quote: ... Dehydrated samples were rehydrated through a series of methanol/PBS washes for 10 minutes each at room temperature with an additional 3 x 10 minutes PBSTw (0.1% Tween-20) and treated with proteinase K (1:1000, Bioline) for 20 minutes to increase permeabilization ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2.5 µl of 1:10 diluted cDNA was added to 7.5 µl of Sensi-FAST SYBR No-ROX (Bioline) and 400 nM of forward and reverse primers in a 15 µl final volume ...
-
bioRxiv - Plant Biology 2023Quote: ... Real-time RT-PCR was performed on 1:10 diluted cDNA using the SensiFAST SYBR No-ROX Kit (Bioline). Three biological and technical replicates were analyzed per genotype ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.25– 1 µg of RNA was reverse-transcribed into cDNA using the SensiFAST cDNA Synthesis Kit (Bioline, BIO-65054). Real-time PCR was performed on the CFX384 Touch real-time PCR detection system (Bio-Rad ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2.5 µl of 1:10 diluted cDNA was added to 7.5 µl of Sensi-FAST SYBR No-ROX (Bioline) and 400 nM of forward and reverse primers in a 15 µl final volume ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR was done using gene-specific primers (see Supplemental Table 1) in technical triplicates on a LightCycler 480 system using the Sensifast SYBR Master mix (Bioline). The ratio of experimental target mRNA to an ACTIN control for each sample was calculated by Applied Biosystems software ...
-
bioRxiv - Molecular Biology 2020Quote: ... For RT-qPCR cDNA was prepared from 1 µg of total RNA using the SensiFAST cDNA Synthesis Kit (BIO-65054, Bioline) and analysed by qPCR using the SensiFast SYBR Lo-ROX Kit (BIO-94050 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... qRT-PCR was carried out on 1:10 diluted cDNA on an Applied Biosystems StepOnePlus system using Sensifast Hi-Rox Sybr kit (Bioline). Cycle conditions were as follows ...
-
Safety and efficacy of C9ORF72-repeat RNA nuclear export inhibition in amyotrophic lateral sclerosisbioRxiv - Systems Biology 2021Quote: ... 1 µg RNA (iNeurons samples) or 2 µg RNA (Drosophila samples) was converted to cDNA using BioScript Reverse Transcriptase (Bioline). qRT–PCR primers were designed using Origene or Primer-BLAST and validated using a 1 in 4 serial template dilution series (standard curve with R2>0.97) ...
-
bioRxiv - Plant Biology 2021Quote: ... Amplicons for sequencing were generated by PCR using degenerate primers (see Supplemental Table 1) for each locus using My Taq HS mix (Bioline) and gel purification ...
-
bioRxiv - Microbiology 2020Quote: ... Real-time PCR reactions were performed in 12 μL mixtures containing 1 x SensiFAST SYBR No-ROX mix (Bioline, Australia), 400 nM of each forward and reverse primer (Table 3 ...
-
bioRxiv - Immunology 2022Quote: ... DNA amplifications for the conTRT amplicons were performed similarly except Ranger DNA polymerase (1×10-6 approximate error/bp) from Bioline was utilized ...
-
bioRxiv - Neuroscience 2019Quote: ... PCR reactions were performed using 5μl cDNA mix and 200nM custom-designed primers (Table 1) and SensiMix (Bioline, London, UK). qPCR data were analysed using ΔCt methods as described previously [Isles et al. ...
-
bioRxiv - Plant Biology 2020Quote: ... Final elution was performed with 40 µl DNA/RNAase-Free water supplied and the eluted RNA was subsequently quantified using a ND-1000 Spectrophotometer (NanoDrop Technologies) and quantified on a 1% (w/v) agarose gel (Bioline) by electrophoresis ...
-
bioRxiv - Cell Biology 2021Quote: mRNA was isolated using NucleoSpin® RNA Plus (Machery-Nagel) and 1 µg of total mRNA was reverse-transcribed into cDNA using SensiFASTTM cDNA Synthesis Kit (Bioline) according to the manufacture’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... Presence of the subfamilies in the genomes of additional strains (Table 1) was tested by PCR using the MyTaq polymerase (Bioline) and the primers listed in Sup ...
-
bioRxiv - Cancer Biology 2023Quote: ... Isolated RNA (0.5-1 µg) was then used for reverse transcription into first strand cDNA via a SensiFast cDNA synthesis kit (Bioline). RNA spike I (TATAA ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... qRT-PCR was carried out on 1:2 diluted cDNA on an Applied Biosystems StepOnePlus system using a Sensifast Hi-Rox SYBR kit (Bioline). Cycle conditions were as follows ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... 20 µl of the epPCR served as a template for a second 1 ml standard PCR with 25 cycles using BioTaq polymerase (Bioline) and primers CW1&2 as previously described49 ...
-
bioRxiv - Microbiology 2021Quote: ... Each reaction (20 μL) consisted of 1 μL of cDNA substrate and 19 μL of a SensiFAST No-ROX Kit Master Mix (Bioline, UK). Following primer optimisation ...
-
bioRxiv - Developmental Biology 2020Quote: cDNA was diluted 1:10 in nuclease-free water and subsequently applied for qRT-PCR using the SensiFast™SYBR HiROX Kit (Bioline) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... and 1 μL of the obtained cDNA was used for real-time PCR with SYBR™ green master mix (Bioline, Luckenwalde, Germany) on a C1000 Touch™ Thermal Cycler (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 ng of the total RNA was reverse-transcribed into cDNA using a Tetro cDNA synthesis kit (BIO-65042, Bioline, London, UK). Quantitative PCR (RT-qPCR ...
-
bioRxiv - Plant Biology 2023Quote: ... A total of 1 µg of total RNA was used to initiate cDNA synthesis using the SensiFAST™ cDNA Synthesis Kit (Bioline, London, UK). The SYBR Green assay with SensiFAST™ SYBR no ROX kit was used for the quantification of transcripts in RT-PCR ...
-
bioRxiv - Genetics 2022Quote: ... The Endpoint PCR amplification (gDNA concentration of 20-50 ng μl−1 per sample) for each target region were performed using MyFi™ DNA Polymerase Kit (Bioline GmbH, Luckenwalde, Germany) and specific primers (IDENTXX GmbH)in a PCR thermal cycler (T100 PCR thermal cycler ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... from Mediterranean and temperate species had germinated we transplanted up to 20 seedlings each into 9 × 9 cm pots (one plant per pot) with a 3:1 mixture of potting soil (Einheitserde®, BioLine, Topfsubstrat Öko torffrei) and sand (0-2 mm play sand ...
-
bioRxiv - Microbiology 2020Quote: ... 2uL of the DNA extracted from sputum samples was used as a template in 20-mL qPCR reactions containing 1× SensiFAST™ Probe Hi-ROX (Bioline, Cat. No. BIO-82020), 200 nM probe ...
-
bioRxiv - Neuroscience 2019Quote: A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...
-
bioRxiv - Physiology 2021Quote: ... was performed with three primers (Figure 1 A, “a”: AAGGCGCATAACGATACCAC, “b”: TACAATGCAGGCTCCAAACAC, “c”: CGAGCACAGGAAGTTCAACA, Eurofins Genomics, Ebersberg/Germany) and the ImmoMix™ kit (Bioline, Cat. No BIO-25020) according to the manufacturer’s instructions.