Labshake search
Citations for Bioline :
101 - 150 of 865 citations for DNA Purification kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... run with Hyperladder 1 DNA marker (Bioline). Selected clones were confirmed to have centrosomal localisation as expected by Airyscan confocal imaging ...
-
bioRxiv - Molecular Biology 2021Quote: ... and ultra-stable Taq DNA polymerase (Bioline). Amplicons were subjected to electrophoresis through 1% w/v agarose ...
-
bioRxiv - Plant Biology 2024Quote: ... 0.125 uL Immolase™ DNA polymerase (Bioline), 10 uL DNA for a total of 10ng input ...
-
bioRxiv - Molecular Biology 2020Quote: The CAN1 locus from genomic DNAs of mutants was amplified in a 96-well format using MyTaq DNA polymerase (Bioline). Each PCR product was uniquely barcoded using primers that contained 20 nt of CAN1-specific sequence conjugated to 16 nt of PacBio forward or reverse barcodes (https://github.com/PacificBiosciences/Bioinformatics-Training/blob/master/barcoding/pacbio_384_barcodes.fasta) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The approximately 75bp M13 fragment was amplified from linear double stranded DNA template (gBlock-CaM-Linker-M13, IDT) using Accuzyme DNA polymerase (Bioline) using DNA primers P21 – P28 listed in Table 1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1 μL of DNA was used in a PCR reaction using 0.3 μΜ primers and 5U of MyTaq DNA polymerase (Bioline).
-
bioRxiv - Cancer Biology 2023Quote: ... Amplicon PCR was conducted using 50ng of DNA (or 20ng for samples with lower DNA yield) along with 2x Accuzyme mix (Bioline) to amplify barcodes using the following primer sequences (Forward - ACTGACTGCAGTCTGAGTCTGACAG ...
-
bioRxiv - Zoology 2021Quote: ... 2.4 U IMMOLASE DNA Polymerase (Bioline, London, UK) and 3 µL diluted DNA ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.125 µl MyTaq DNA polymerase (Bioline, London, UK), and 7.5 ng/µl of DNA template ...
-
bioRxiv - Cancer Biology 2020Quote: ... DNA weight marker Hyperladder™ 1-kb (BIoline) and UltraRanger 1kb (Norgen Biotek ...
-
bioRxiv - Microbiology 2022Quote: ... 12 μl MyTaq Red DNA polymerase Mix (BioLine) and 1 μl of each primer (10 μmol) ...
-
bioRxiv - Microbiology 2022Quote: ... 6 μl MyTaq Red DNA polymerase Mix (BioLine) and 1 μl of each primer (10 μmol) ...
-
bioRxiv - Microbiology 2022Quote: ... 12 μl MyTaq Red DNA polymerase Mix (BioLine) and 1 μl of each primer (10 μmol) ...
-
bioRxiv - Microbiology 2021Quote: ... For the PCR master mix (MM) MangoTaq DNA polymerase and MyTaq DNA Polymerase were used and all PCR reagents were from Bioline (London, UK). To reduce the PCR inhibitors 0.4 μg μL−1 of bovine serum albumin (BSA ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... consisting of 5 μL MyTaq HS DNA Polymerase (Bioline), 0.2 μL of each forward and reverse primer ...
-
bioRxiv - Microbiology 2019Quote: ... 0.5 μL MyTaq™ HS DNA-Polymerase (Bioline, UK) (5 UμL) ...
-
bioRxiv - Pathology 2019Quote: ... 0.03 U/µl Taq DNA polymerase (Bioline, Luckenwalde, Germany) and 0.1x SYBR Green I solution (Invitrogen ...
-
bioRxiv - Genomics 2019Quote: ... Cycling conditions for VELOCITY DNA polymerase-based amplification (Bioline) were 97 °C for 3 min ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR was performed with BIOTAQ DNA Polymerase (Bioline, UK) using the following program ...
-
bioRxiv - Microbiology 2020Quote: ... 1 ng human genomic DNA (Bioline, Cat. # BIO-35025) was used as negative control ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR was conducted using BIOTAQ DNA polymerase (Bioline, USA). PCR conditions consisted of an initial denaturation step at 94°C for 1 min and 30 cycles of amplification ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.2 μl of MyTaq DNA polymerase (Bioline, London, UK) and 4 μl of 5X MyTaq reaction buffer (Bioline ...
-
bioRxiv - Plant Biology 2022Quote: ... Converted DNA was PCR-amplified by MyTaq polymerase (Bioline) for 12 cycles ...
-
bioRxiv - Molecular Biology 2020Quote: ... and amplified via PCR using MyTaq DNA polymerase (Bioline).
-
bioRxiv - Biochemistry 2021Quote: A ds-DNA ladder (HyperLadder 25-500 bp, Bioline) was pre-stained with Sybr-Gold (SG ...
-
bioRxiv - Neuroscience 2019Quote: ... and amplified with MyTaq™ Red DNA Polymerase (Bioline). The deletion of the Tet2 gene was determined by analysis of DNA extracted from isolated primary microglia using a QuickExtract™ (Epicentre ...
-
bioRxiv - Neuroscience 2019Quote: ... and amplified with MyTaq™ Red DNA Polymerase (Bioline).
-
bioRxiv - Molecular Biology 2021Quote: ... 0.2 μl of MyTaq DNA polymerase (Bioline, London, UK) and 1 μl of DNA template ...
-
bioRxiv - Genetics 2022Quote: PCRs were performed using MyTaq HS DNA Polymerase (Bioline). Reaction mixes contained 5 μl 5x MyTaq Reaction Buffer ...
-
bioRxiv - Genomics 2022Quote: ... and amplified via PCR using MyTaq DNA polymerase (Bioline). Following amplification ...
-
bioRxiv - Plant Biology 2022Quote: ... Converted DNA was PCR-amplified by MyTaq polymerase (Bioline) for 12 cycles ...
-
bioRxiv - Genetics 2023Quote: PCR validations were performed using MyTaq DNA polymerase (Bioline), including 20 pmol of each primer (Additional file 6) ...
-
bioRxiv - Cell Biology 2023Quote: ... and RT-PCR performed using MyTaq DNA polymerase (Bioline). Fifty cycles of PCR were performed in order to identify low expressed transcripts ...
-
bioRxiv - Genomics 2023Quote: ... Bisulfite PCR reactions used MyTaq HS DNA polymerase (Bioline), and contained 1× reaction buffer ...
-
bioRxiv - Genetics 2024Quote: ... and 0.06 units of Velocity DNA Polymerase (Bioline, UK) and 50 ng of template DNA ...
-
bioRxiv - Genetics 2024Quote: ... and 0.12 units of Velocity DNA Polymerase (Bioline, UK) and 0.5 μL of first round PCR product as template.
-
bioRxiv - Microbiology 2021Quote: ... and 1.25 U BIOTAQ™ DNA Polymerase (Bioline, London, UK). A Mastercycler Nexus GSX1 (Eppendorf ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR was performed with MyTaq DNA or Myfi Polymerases (Bioline) and primers were designed (Suppl ...
-
bioRxiv - Developmental Biology 2022Quote: ... The DNA was PCR amplified using the MyTaq polymerase (Bioline). DNA was sonicated to an average size of 300bp and adaptors were removed by AlwI (NEB ...
-
bioRxiv - Genomics 2019Quote: ... followed by cDNA amplification using MyTaq DNA polymerase (Bioline, MA). The Nextera XT kit (Illumina ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR was carried out using Velocity proofreading DNA polymerase (Bioline) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... RT-PCR analysis was performed using Immolase DNA polymerase (Bioline) and fragments were separated on 2% argarose gels ...
-
bioRxiv - Genetics 2019Quote: ... PCR amplification was performed with MyTaq DNA Polymerase (Bioline BIO-21108) and purified with Qiagen QIAquick PCR Purification kit (Qiagen 28104) ...
-
bioRxiv - Genetics 2021Quote: ... 0.125 μL IMMOLASE™ DNA Polymerase (5 u/μL) (Bioline (Aust) Pty Ltd ...
-
bioRxiv - Biochemistry 2021Quote: ... The amplified DNA was transformed into α-select competent cells (Bioline) by heat shock and plated on Luria-Bertani broth (LB ...
-
bioRxiv - Immunology 2020Quote: ... Target mRNAs were amplified using MyTaq HS DNA Polymerases (Bioline, UK), and amplicons were run on 1% agarose gels ...
-
bioRxiv - Microbiology 2022Quote: ... PCR reactions were performed using MyTaq™ Red DNA Polymerase (Bioline) in a Bio-Rad® thermocycler with the following program ...
-
bioRxiv - Microbiology 2022Quote: ... 0.5 U of thermoestable Biotaq™ DNA polymerase (BioLine, Randolph, MA) and 5 μl of DNA template ...
-
bioRxiv - Microbiology 2019Quote: ... using the amplification kit SensiFAST SYBR No-Rox kit (Bioline, London, UK), according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: Gene and promoter amplification were performed using MyFi™ DNA Polymerase (Bioline). FvMYB10-gypsy and Fvb1 FIN12 genomic fragments flanking the deleted region were both amplified with 5Prime PCR Extender System (5Prime ...