Labshake search
Citations for Bioline :
151 - 200 of 274 citations for DNA Polymerase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
FTSH3 facilitates complex I degradation through a direct interaction with the complex I subunit PSSTbioRxiv - Plant Biology 2023Quote: ... RT-qPCR standards were generated from Col-0 cDNA pool using MyTaq polymerase mix (Bioline) and purified using Favorprep PCR Purification Kit (Favorgen ...
-
bioRxiv - Bioengineering 2019Quote: ... DNA was extracted using the genomic DNA isolate kit from Bioline (BIO52067). The DNA pellet was resuspended in ultra-purified water and used for PCR analysis ...
-
bioRxiv - Genetics 2021Quote: ... genomic DNA was extracted using the ISOLATE II Genomic DNA kit (Bioline). Following DNA amplification and fragmentation according to the associated Illumina HTS assay protocol samples were hybridized to an Infinium PsychArray v1.1 BeadChip (Illumina) ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted using ISOLATE II Plant DNA extraction kit (Bioline, 52070) following manufacturer’s recommendations and CTAB lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA was isolated using the ISOLATE II Genomic DNA Kit (Bioline) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... genomic DNA was isolated using the ISOLATE II Genomic DNA Kit (Bioline) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... DNA was extracted using the ISOLATE II Genomic DNA Kit (Bioline, London, UK) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... 100ng of each gene specific forward and reverse primer and 0.2μl of Biolase Taq polymerase (Bioline) in a 20μL reaction ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was extracted using an Isolate II Genomic DNA extraction kit (Bioline, NSW, Australia). DNA was amplified with strain-specific primers using a Rotor-Gene Q machine (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... mutants were selected by PCR screening of colonies grown on LBN + 5% sucrose using Taq polymerase (Bioline) and the primers RSTX_For (5’-GTCACGGGTTGATTGATTCGCAT-3’ ...
-
bioRxiv - Genetics 2021Quote: Quantitative polymerase chain reaction (qPCR) was performed using SensiFAST™ SYBR No-ROX Kit (Bioline, BIO-98020) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... both samples were subjected to PCR with human GAPDH-specific primers41 and MyTaq polymerase (Bioline, Taunton, MA). Resulting PCR amplicons were visualized by agarose gel electrophoresis ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... DNA was extracted using a Bioline Isolate II Genomic DNA Isolation Kit (Bioline, Eveleigh, Australia) following the manufacturers’ instructions ...
-
bioRxiv - Microbiology 2021Quote: ... DNA extraction was done using either the Bioline DNA extraction kit (Bioline Corporation, London, UK) or the CTAB (Cetyl Trimethyl Ammonium Bromide ...
-
bioRxiv - Microbiology 2019Quote: DNA was isolated from cells using the Isolate II Genomic DNA kit (Bioline, NSW, Australia) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... performed genomic DNA (gDNA) extraction with the ISOLATE II genomic DNA kit (Bioline, BIO-52067) and diluted DNA to 50 ng/μl ...
-
bioRxiv - Microbiology 2023Quote: Genomic DNA for genome sequencing was isolated using the ISOLATE II Genomic DNA Kit (Bioline). For identification of DNA alterations in strain K18 ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from the FTATM card using an ISOLATE II Genomic DNA Kit (Bioline) with a pre-lysis in 180 µL of Lysis Buffer GL and 25 µL Proteinase K for 2 hours before completing the extraction as per manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genomic DNA was extracted using an Isolate II Genomic DNA Kit (Bioline, Meridian Bioscience Australia), following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... Primers flanking the MT-ND4 gene were used to amplify the edited locus using MyTaq polymerase (Bioline, USA). PCR amplicons were gel extracted and purified using QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2020Quote: ... Genomic DNA was extracted using the ISOLATE II Genomic DNA kit (Bioline cat. no. BIO-52067) and DNA was processed for high-throughput sequencing similar to conventual DamID (Vogel et al. ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted from the enriched viral nucleocapsids using the Isolate II genomic DNA kit (Bioline) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Genomic DNA was isolated three days after transduction (ISOLATE II Genomic DNA kit, Bioline BIO-52067), without stabilization of the Dam fusions to keep expression at low levels ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA was isolated using 200 μL of parasite culture (Isolate II Genomic DNA kit, Bioline). Candidate actinonin resistance genes were amplified using the primers listed in Supplementary Table 3 ...
-
bioRxiv - Genomics 2023Quote: Genomic DNA was extracted using either the Bioline Isolate II Genomic DNA Kit (Bioline, Eveleigh, Australia) following the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2020Quote: ... Human genomic DNA purchased from Bioline Australia (Cat No ...
-
bioRxiv - Microbiology 2020Quote: ... using QuickStick T4 DNA Ligase (Bioline) and transformed into E ...
-
bioRxiv - Genetics 2019Quote: ... Final injection DNA concentration was brought up to 150 ng/μl using DNA ladder (1kb HyperLadder – Bioline).
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR reactions were carried out using 1.5 mM MgCl2 and 1X NH4 buffers for 1U of BioTaq polymerase (Bioline), 0.2 mM dNTP mix ...
-
bioRxiv - Molecular Biology 2021Quote: ... Each sample was measured in triplicate of 5 μl with the following final concentrations: Velocity Polymerase 0.6 U (Bioline), 1.2 x Hifi Buffer (Bioline) ...
-
bioRxiv - Molecular Biology 2019Quote: DNA was extracted from surface-sterilized whole insects using the ISOLATE II Genomic DNA Kit (Bioline, London, UK) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... DNA from historical museum toepad samples was extracted using the Bioline Isolate II Genomic DNA extraction kit (Bioline), but suspending tissues in 400 μL lysis buffer with 25 μL proteinase k and incubated overnight at 55 °C ...
-
bioRxiv - Microbiology 2022Quote: Faecal DNA was extracted from FecalSwabTM media (200µL) using the ISOLATE II Fecal DNA Kit (Bioline, Sydney, Australia) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genomic DNA was extracted from parasite lines using an Isolate II Genomic DNA Kit (Bioline, Meridian Bioscience Australia), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... run with Hyperladder 1 DNA marker (Bioline). Selected clones were confirmed to have centrosomal localisation as expected by Airyscan confocal imaging ...
-
bioRxiv - Genomics 2021Quote: ... ans Isolate II Genomic DNA kit (Bioline) was used to extract genomic DNA from 1×107 cells ...
-
bioRxiv - Genomics 2022Quote: ... Presence of the subfamilies in the genomes of additional strains (Table 1) was tested by PCR using the MyTaq polymerase (Bioline) and the primers listed in Sup ...
-
bioRxiv - Cell Biology 2023Quote: ... and used as a template for quantitative polymerase chain reaction with reverse transcription (qRT–PCR) analysis using SensiFAST SYBR Lo-ROX Kit (Bioline). Samples were analyzed using a QuantStudio 3 Real-Time PCR System (ThermoFisher) ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... 20 µl of the epPCR served as a template for a second 1 ml standard PCR with 25 cycles using BioTaq polymerase (Bioline) and primers CW1&2 as previously described49 ...
-
bioRxiv - Microbiology 2021Quote: ... Genomic DNA was extracted from FecalSwab™ sample media (200μL) using the ISOLATE Fecal DNA kit (Bioline, Sydney, Australia) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... After three washes with ice-cold PBS genomic DNA was isolated using the ISOLATE II Genomic DNA Kit (Bioline) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and a sample was taken for DNA extraction and purification using an Isolate II Genomic DNA purification kit (Bioline). Also ...
-
bioRxiv - Immunology 2021Quote: ... The master mix was prepared with 2.5 mL of 2X buffer containing Taq-polymerase was prepared from the TaqMan RT-PCR kit (Bioline #BIO-78005). From the kit ...
-
Genomic and phenotypic characterization of finger millet indicates a complex diversification historybioRxiv - Genetics 2021Quote: ... Genomic DNA (gDNA) was extracted from finely-ground leaf material using the ISOLATE II Genomic DNA Kit (Bioline Pty Ltd) and according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... ChIP DNA and input DNA were diluted 5X and amplified using 500 nM primers and SensiFAST SYBR (No-ROX Kit, Bioline) using a LightCycler 480 (Roche).
-
bioRxiv - Cancer Biology 2023Quote: ... Amplicon PCR was conducted using 50ng of DNA (or 20ng for samples with lower DNA yield) along with 2x Accuzyme mix (Bioline) to amplify barcodes using the following primer sequences (Forward - ACTGACTGCAGTCTGAGTCTGACAG ...
-
bioRxiv - Genomics 2021Quote: ... using the ISOLATE II Genomic DNA Kit (Bioline). We prepared 3 samples of 10 ovarioles for each genotype (green and orange) ...
-
bioRxiv - Cancer Biology 2020Quote: ... DNA weight marker Hyperladder™ 1-kb (BIoline) and UltraRanger 1kb (Norgen Biotek ...
-
bioRxiv - Immunology 2022Quote: ... genomic DNA (gDNA) was isolated from mouse brains or dural meninges using the Isolate II Genomic DNA Kit (Bioline, BIO-52067) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: DNA was isolated from whole adult BF and HIE-18 cells using an Isolate II Genomic DNA kit (Bioline, NSW, Australia) following the manufacturer’s protocol ...