Labshake search
Citations for Bioline :
351 - 400 of 936 citations for DNA Damage 8 OHdG ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... and reverse transcribed using the SensiFAST cDNA synthesis kit (Bioline), according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2020Quote: ... cDNA was transcribed using the SensiFAST cDNA Synthesis Kit (Bioline). Naïve and primed marker expression was determined by qPCR using the Sensifast SYBR No Rox-Kit (Bioline) ...
-
bioRxiv - Cell Biology 2020Quote: ... using the Sensifast SYBR No Rox-Kit (Bioline, BIO-98020). Expression levels were normalized to either L32 or Actin ...
-
bioRxiv - Cell Biology 2020Quote: ... The Sensifast SYBR no-rox Kit (ref. BIO-98005, Bioline) and a Rotor Gene Q Real-Time PCR (Qiagen ...
-
bioRxiv - Bioengineering 2020Quote: ... using the SensiMix™ Kit and SYBRGreen (Bioline, Luckenwalde, Germany). For each triplicate cDNA amounts corresponding to 50 ng RNA were used and measurements were conducted in a LightCycler® 480 (Roche ...
-
bioRxiv - Cancer Biology 2020Quote: ... and SensiMix SYBR No-ROX Kit™ (Bioline, QT650-20), using RPLP0 as a reference gene ...
-
bioRxiv - Cell Biology 2021Quote: ... and the SensiFAST™ SYBR® No-ROX Kit (Bioline), following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNAs were prepared using the SensiFAST cDNA Synthesis Kit (Bioline). Quantitative real-time PCR reactions using cDNA samples as template were carried out using a SensiFAST SYBR No-ROX Kit (Bioline ...
-
bioRxiv - Microbiology 2020Quote: ... Products were purified (Isolate II PCR and Gel kit, Bioline) and Sanger sequenced (Australian Genome Research Facility ...
-
bioRxiv - Cancer Biology 2020Quote: ... qPCRs were run using SensiFAST SYBR No-ROX Kit (Bioline) and a Roche LightCycler 384 ...
-
bioRxiv - Neuroscience 2022Quote: ... and quantitative PCR with the library quantification kit from Bioline Jet Set Library Quantification Kit LoROX (Meridian Bioscience ...
-
bioRxiv - Plant Biology 2021Quote: ... with the SensiMix Kit and SYBR Green (Bioline, Luckenwalde, Germany). Negative controls without template addition ...
-
bioRxiv - Neuroscience 2021Quote: ... 5μl SensiFAST SYBR Green No-ROX Kit (BIOLINE, BIO-98020), and 2μl of DNAse/RNAse-free water ...
-
bioRxiv - Microbiology 2021Quote: ... 125nM) and SensiFAST Probe Hi-ROX One-Step Kit (Bioline) according to the manufacturer’s instructions in a 20μl reaction with 5μl sample ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA preparation was performed using SensiFAST cDNA Synthesis Kit (Bioline) and real-time qPCR was performed using SensiFast SYBR Lo-ROX kit (Bioline) ...
-
bioRxiv - Immunology 2022Quote: ... obtained from the TaqMan RT-PCR kit (Bioline #BIO-78005), was added to a 15 ml tube ...
-
bioRxiv - Microbiology 2020Quote: ... The Sensi-FAST SYBR Hi-ROX One-Step Kit (Bioline) was used for quantitative real time PCR (qRT-PCR) ...
-
bioRxiv - Physiology 2020Quote: ... SensiFAST™ SYBR® Lo-ROX Kit (Bioline, TN, USA) was used to amplify cDNA using primers listed in Table S2 ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was reverse transcribed using SensiFast cDNA Synthesis Kit (Bioline), and SYBR green PCR analysis was performed using Kapa HiFi HotStart Ready Mix (Roche ...
-
bioRxiv - Physiology 2019Quote: ... reagent and ISOLATE II RNA Mini kit (Bioline, #BIO-52073). Isolated RNA was reverse transcribed using iScript cDNA Synthesis Kit (Biorad ...
-
bioRxiv - Cancer Biology 2019Quote: ... and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: RNA was isolated using ISOLATE II RNA Mini Kit (Bioline) according to the manufacturers’ instructions with minor adjustments ...
-
bioRxiv - Microbiology 2021Quote: ... braarudii cells using the Isolate II RNA Mini Kit (Bioline) with on column DNA digestion ...
-
bioRxiv - Microbiology 2021Quote: ... with Sensi-FAST Probe Hi-ROX qPCR kit (Bioline, 82005) (8).
-
bioRxiv - Immunology 2021Quote: ... using the SensiFAST SYBR No-ROX Kit (Bioline, Meridian Bioscience). Hprt1 was used as a housekeeping gene and the standard curve method was used for quantification ...
-
bioRxiv - Developmental Biology 2022Quote: ... purified using ISOLATE II PCR and Gel Kit (Bioline, Australia) and Sanger sequenced at the Australian Genome Resource Facility (AGRF) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The protocol used the SensiFAST No-ROX kit (Bioline #98020) and a LightCycler 480 system for detection ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was synthesized using the SensiFast cDNA synthesis kit (Bioline) and SETD7 and GAPDH levels measured by qPCR were used as positive and negative control respectively ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was reverse transcribed by Tetro cDNA synthesis kit (Bioline) with the primer of ‘GAGCAAAGACCCCAACGAGA’ targeting MBaMV-GFP genome ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative PCR was performed using SensiFAST™ SYBR kit (BIOLINE). The primer sequences used for qPCR are listed in Table S1 ...
-
bioRxiv - Immunology 2023Quote: ... RNA was isolated using ISOLATE II RNA Mini Kit (Bioline) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline). Gene expression was measured using qRT-PCR using TaqMan (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline). Gene expression was measured using qRT-PCR using TaqMan (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was isolated using Isolate II RNA Mini Kit (Bioline) and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline) ...
-
bioRxiv - Genomics 2023Quote: ... qPCR was performed using the SensiFAST SYBR NoROX Kit (Bioline) supplemented with 0.2μM of specific primer pairs (Table S9 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Reactions were performed with SensiFAST SYBR Hi-ROX kit (Bioline), and all samples and negative controls were run in technical duplicate on an Applied Bioscience StepOnePlus qPCR machine (Life Technologies).
-
bioRxiv - Neuroscience 2023Quote: ... and reverse transcribed using the SensiFast cDNA Synthesis Kit (Bioline). Quantitative real-time PCR was performed in triplets for each sample using the LightCycler DNA Master SYBR Green I Kit in a LightCycler 480 System (Roche) ...
-
bioRxiv - Cell Biology 2023Quote: ... and cDNA was synthesized using a SensiFast cDNA kit (Bioline) using manufacturer’s instructions from 250 ng of RNA ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA was generated using the Tetro cDNA Synthesis Kit (Bioline) and the Uni12 primer (5’-AGCAAAAGCAGG-3’ ...
-
bioRxiv - Developmental Biology 2024Quote: ... using the Sensifast SYBR no Rox kit (Bioline, BIO-98020). Data analysis and visualisation was performed using Microsoft Excel (Office 365 ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCR was done using 10 ng (broth culture) or 100 ng (fecal samples) of genomic DNA as template with SYBR Green Real-Time qPCR reagents (Bioline), primers at a final concentration of 1 μM ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 were generated from 200 ng genomic DNA (gDNA) using junction-specific primers (Table S4) by a two-step nested PCR with Velocity polymerase (Bioline). The first PCR reaction was performed for 15 cycles with 60 °C annealing and 30 s elongation and then purified with AMPure XP PCR beads (Beckman Coulter) ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA was then used to generate the probe template by standard PCR using the MyTaq™ HSRED DNA Polymerase (Bioline) and opsin specific primers (listed in Table S2 ...
-
bioRxiv - Genetics 2019Quote: ... We tested the primers on DNA extracted from the liver of Mongolian gerbil and fat sandrat using the MyTaq Red Mix (Bioline). In each 25ul PCR reaction ...
-
bioRxiv - Microbiology 2019Quote: ... a total volume of 25μL was prepared as mastermix with 5μL as DNA template and 20μL constituting of My Taq ™ Red Mix (Bioline; UK) 12.5μL ...
-
bioRxiv - Genetics 2021Quote: ... cCREs and promoters were amplified from mouse genomic DNA (extracted fromE14TG2a mESCs, ATCC CRL-1821) by PCR using My-Taq Red mix (#BIO-25044; Bioline) in 384 well plates using automated liquid handling (Hamilton Microlab® STAR) ...
-
bioRxiv - Microbiology 2022Quote: ... and conducted at 100V for 30 min with product size approximated using HyperLadder II 50bp DNA marker (Bioline, Sydney, Australia).
-
bioRxiv - Molecular Biology 2022Quote: ... and insertions were validated as empty/filled and/or by 5’ and 3’ junction PCRs using MyTaq HS DNA polymerase (Bioline). Validation products were run on 1% agarose gels ...
-
bioRxiv - Microbiology 2023Quote: ... A fragment of each gene was individually amplified by polymerase chain reaction (PCR) from the leaf DNA extracts using the MyTaq reaction buffer and polymerase (Bioline) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Indexing PCRs were created by combining 10 μL of purified DNA with 10 μL 2x MyTaq HS Mix polymerase (Bioline) and 1 μl (5 μM ...