Labshake search
Citations for Bioline :
1 - 50 of 763 citations for C Reactive Protein CRP ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... and 5-µL of SensiFAST SYBR & Fluorescein Kit (Bioline). Each sample was measured in triplicate ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 5 μl of 2X SensiFAST SYBR No-ROX kit (Bioline) in a 10 μl total volume ...
-
bioRxiv - Plant Biology 2023Quote: ... qPCR was performed in 96-well plates using the SensiFastTM SYBR No-ROX Kit (Bioline) in technical triplicates for each biological replicate ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was extracted using the ISOLATE II RNA/DNA/Protein kit (Bioline, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: RNA was isolated using Bioline II DNA/RNA/Protein extraction kit (Bioline, Australia) following the manufacturer’s protocol ...
-
bioRxiv - Pathology 2024Quote: ... then incubated overnight at 37°C with staining buffer (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside [X-gal, Bioline, London ...
-
bioRxiv - Cancer Biology 2021Quote: ... Quantitative RT-PCR was performed using SensiMix SYBR Low-ROX Kit (Bioline; annealing temperature – 60°C) in a Lightcycler 480 384-well plate (Roche) ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA synthesis was performed with 0.25-1 µg of RNA in a 20 µL total reaction volume using a random hexamer/oligo dT strand synthesis kit as per the manufacturer’s instructions (10 min at 25°C; 15 min at 42°C; 15 min at 48°C; SensiFast, Bioline). All oligonucleotide sequences are listed in Table 1.
-
bioRxiv - Microbiology 2020Quote: ... and cDNA synthesized with 0.25-1μg of RNA in a 20μL total reaction volume using a random hexamer/oligo dT strand synthesis kit in accordance with the manufacturer’s instructions (10 minutes at 25°C; 15 minutes at 42°C; 15 minutes at 48°C; SensiFast, Bioline). PCR amplification of HBV RNAs were performed using primers as previously described43 using a SYBR green real-time PCR protocol (qPCRBIO SyGreen ...
-
bioRxiv - Plant Biology 2023Quote: Measurements were carried out in 96-well plates using the SensiFAST™ SYBR® Kit (Bioline, Luckenwalde, Germany) in a LightCycler® 480 (Roche) ...
-
bioRxiv - Physiology 2022Quote: ... qPCRs were carried out in 15 μl in a 384-well plate using SensiFASTTM SYBR Hi-ROX kit (Bioline), 0·5 μM of each forward and reverse primer and 2·5 μl of template DNA ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 µl of (2x) SYBR green master mix (SensiFAST SYBR kit, Bioline, London, United Kingdom; BIO- 94005) was used and combined with 0.4 µl of a combined forward and reverse primer mix (10 uM of forward and reverse primers in the combined master mix ...
-
bioRxiv - Genetics 2019Quote: ... cDNA was diluted in nuclease-free water and stored at −20°C until used in qPCR with the SensiFastTM SYBR® No-ROX kit (Bioline) and a Lightcycler® 480/1536 (Roche ...
-
bioRxiv - Microbiology 2020Quote: Bacterial cultures were grown in Luria Bertani (LB) broth for 18-24h at 37 °C and DNA was extracted using the Isolate II Genomic DNA Kit (Bioline, UK) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Then 5 μg of the extracted RNA was reversely transcribed by utilizing Tetro cDNA Synthesis Kit (Bioline, BIO-65043) and random Hexamer Primer according to the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2019Quote: ... with total reaction volume of 10 μl containing 5 μl Rotor-Gene SYBR® Green PCR Kit (Bioline, Australia), 0.3 μl each of 10 μM forward and reverse primer and 2 μl of genomic DNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4.2 µL purified DNA from chromatin immunoprecipitation was mixed with 5 µL 2x SensiFAST SYBR No-ROX kit (Bioline) and 0.4 µL forward and reverse primer (10 µM) ...
-
bioRxiv - Microbiology 2021Quote: RNA from GP barley infected with Fg-IFA65 at 5 dpi and an uninfected control was extracted with the Isolate II plant miRNA kit (Bioline). 1 µg of RNA (>200 nt ...
-
bioRxiv - Molecular Biology 2020Quote: ... qPCRs were run using 2 µl cDNA (diluted 1:1) in a 10 µl reaction with 5 µl SensiFAST SBYR No-ROX Kit (Bioline) and 0.1 µM of each primer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Isolated RNA (0.5-1 µg) was then used for reverse transcription into first strand cDNA via a SensiFast cDNA synthesis kit (Bioline). RNA spike I (TATAA ...
-
bioRxiv - Microbiology 2023Quote: ... The reactions (10 μL total volume) contained 5 μL of 2 × SensiFAST™ SYBR No-ROX Kit (Bioline, London, UK), 0.2 μM of each arsM gene primer ...
-
bioRxiv - Cancer Biology 2019Quote: ... cDNA was amplified on quantitative PCR in a total volume of 5 μl with SensiFAST SYBR® No-ROX Kit (Bioline) and specific primers on a LightCycler 480 (Roche) ...
-
bioRxiv - Physiology 2021Quote: ... the K13 locus was amplified directly from whole blood using the primer pair p26+p27 (Supplementary file 5) and the MyTaq™ Blood-PCR Kit (Bioline). Primer pairs p39+p40 and p50+p51 were used to amplify fd and mdr2 ...
-
bioRxiv - Physiology 2021Quote: ... was performed with three primers (Figure 1 A, “a”: AAGGCGCATAACGATACCAC, “b”: TACAATGCAGGCTCCAAACAC, “c”: CGAGCACAGGAAGTTCAACA, Eurofins Genomics, Ebersberg/Germany) and the ImmoMix™ kit (Bioline, Cat. No BIO-25020) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: ... 1’ 72°C) by MyTaq Red mix (Bioline) using primers that add overhangs with EcoRI (MT024 ...
-
bioRxiv - Microbiology 2022Quote: ... with a 5μL 5 HyperLadderTM 100bp (Bioline) to confirm product size ...
-
bioRxiv - Molecular Biology 2023Quote: ... This cDNA library was then PCR barcoded with PCR Primer 1.0 (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG-3’) and a sample-specific barcode primer (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTG-3’) using MyTaq Red Mix (Bioline) for 15 cycles ...
-
bioRxiv - Genetics 2023Quote: ... An 800–base pair region surrounding the target site of the Cypor sgRNA was amplified (forward primer 5′-GTTTGCGGGTGTTAGCTCTTC-3′; reverse primer 5′-TTGGTGGGTAAATCACACCGT-3′) using MyTaq Red Mix (Bioline). The amplicon was purified using the PCR clean-up and gel extraction kit (Macherey-Nagel ...
-
Increased ACTL6A Occupancy Within mSWI/SNF Chromatin Remodelers Drives Human Squamous Cell CarcinomabioRxiv - Molecular Biology 2021Quote: ... cells were lysed directly on culture plates with TRIsure reagents (Bioline), and RNA was extracted using Direct-zol RNA MiniPrep kits (Zymo Research ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were set up in total volumes of 10 µl each, containing 5× MyTaq reaction buffer (5 mM dNTPs, 15 mM MgCl2, stabilizers and enhancers) (Bioline, London, UK), 2 µM of each primer ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... consisting of 5 μL MyTaq HS DNA Polymerase (Bioline), 0.2 μL of each forward and reverse primer ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 μl of 2x SYBR green master mix (Bioline), 1μl (5 pmol/μl ...
-
bioRxiv - Immunology 2022Quote: ... using either BIOLASETM polymerase (7×10-5 approximate error/bp) or MyFiTM polymerase (7×10-5 approximate error/bp) both from Bioline (Meridian Bioscience, USA). The PCR mixture consisted of 1X buffer with 1mM dNTP ...
-
bioRxiv - Genomics 2020Quote: ... at 37°C for 30 min and then proteinase K digestion (Bioline, cat. #37084) for 2 h at 56 °C ...
-
bioRxiv - Genomics 2023Quote: ... for 1 hour at 37°C and proteinase K (40 ug, Bioline BIO-37084) for 2 hours at 55°C ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and 2.5-5 μL of Proteinase K (20 mg/mL, Bioline Australia Pty Ltd ...
-
bioRxiv - Microbiology 2021Quote: ... using 5 μl product with 1 μl 5X loading dye (BioLine) to verify bands of approximately 450 bp ...
-
bioRxiv - Genetics 2021Quote: ... 0.125 μL IMMOLASE™ DNA Polymerase (5 u/μL) (Bioline (Aust) Pty Ltd ...
-
bioRxiv - Genomics 2020Quote: ... 2 □1 water and 5□1 MyTaq™ HS Mix (Bioline). RT-PCR was performed in the following conditions ...
-
bioRxiv - Genomics 2022Quote: ... Each reaction contained 5 μl SensiFAST 1x LoRox SYBR Mix (Bioline), 0.25 μl forward primer (10 μM) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Recombinant proteins were produced in Escherichia coli BL21 (DE3) cells (Bioline) as described previously (LaCourse ...
-
bioRxiv - Molecular Biology 2023Quote: ... and vehicle was added to control plates 24 hours before RNA isolation using Trisure (Bioline) per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... and IMMOLASETM DNA polymerase (5 U/μl) (Bioline; Cat. No. BIO-21047) as described by Lee et al ...
-
bioRxiv - Immunology 2020Quote: ... 5 - 10 ng DNA was used for amplification with MyTaq Polymerase (Bioline). The PCR cycling conditions were as follows ...
-
bioRxiv - Microbiology 2022Quote: ... and IMMOLASETM DNA polymerase (5 U/μl) (Bioline; Cat. No. BIO-21047) as described by Lee et al ...
-
bioRxiv - Microbiology 2021Quote: ... 1% SDS (Sigma-Aldrich)] supplemented with 5 μL Proteinase K (20 mg mL−1; Bioline Australia) to lyse cells ...
-
bioRxiv - Biochemistry 2022Quote: ... Protein overexpression was performed using Escherichia coli BL21 (DE3) pLysS cells (BIOLINE) in super broth supplemented with 200 μg/mL ampicillin (AMRESCO ...
-
bioRxiv - Genomics 2019Quote: ... pool C was diluted 1,000-fold and 1.5 fmol were amplified using VELOCITY DNA polymerase (Bioline) with forward primer pool-FP1 and reverse primer pool-RP2 using the following PCR conditions ...
-
bioRxiv - Microbiology 2019Quote: ... using the amplification kit SensiFAST SYBR No-Rox kit (Bioline, London, UK), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Each 100 μl PCR reaction contained 5 U MyTaq DNA polymerase (Bioline, Australia), 1 × MyTaq reaction buffer ...