Labshake search
Citations for Bioline :
1 - 50 of 193 citations for 7H Pyrazolo 4 3 d pyrimidin 7 one 1 4 dihydro 3 b D ribofuranosyl oxime monohydrochloride 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2024Quote: ... then incubated overnight at 37°C with staining buffer (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside [X-gal, Bioline, London ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... from Mediterranean and temperate species had germinated we transplanted up to 20 seedlings each into 9 × 9 cm pots (one plant per pot) with a 3:1 mixture of potting soil (Einheitserde®, BioLine, Topfsubstrat Öko torffrei) and sand (0-2 mm play sand ...
-
bioRxiv - Genetics 2020Quote: ... 4 mM MgCl2 (Bioline); 800nM dNTPs (Bioline) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 mM MgCl (Bioline, Boston, MA), 1 mM dNTP (Bioline ...
-
bioRxiv - Molecular Biology 2023Quote: ... This cDNA library was then PCR barcoded with PCR Primer 1.0 (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG-3’) and a sample-specific barcode primer (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTG-3’) using MyTaq Red Mix (Bioline) for 15 cycles ...
-
bioRxiv - Genetics 2023Quote: ... An 800–base pair region surrounding the target site of the Cypor sgRNA was amplified (forward primer 5′-GTTTGCGGGTGTTAGCTCTTC-3′; reverse primer 5′-TTGGTGGGTAAATCACACCGT-3′) using MyTaq Red Mix (Bioline). The amplicon was purified using the PCR clean-up and gel extraction kit (Macherey-Nagel ...
-
bioRxiv - Neuroscience 2019Quote: A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... subsequently diluted in water (1:4) and mixed with SensiFAST SYBR Hi-Rox (Bioline) and the appropriate primers at a final concentration of 10 μM ...
-
bioRxiv - Microbiology 2021Quote: ... and 3 μL of Proteinase K (20 mg/ mL, Bioline Australia Pty Ltd ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... and 3 μL of Proteinase K (20 mg/ mL, Bioline Australia Pty Ltd ...
-
bioRxiv - Neuroscience 2022Quote: ... Dehydrated samples were rehydrated through a series of methanol/PBS washes for 10 minutes each at room temperature with an additional 3 x 10 minutes PBSTw (0.1% Tween-20) and treated with proteinase K (1:1000, Bioline) for 20 minutes to increase permeabilization ...
-
bioRxiv - Plant Biology 2021Quote: ... cDNA synthesis was performed using an oligo d(T) primer and Tetro Reverse Transcriptase (Bioline). We performed qRT-PCR using the primers in Supplemental Table 1 and SYBR green supermix ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μl of 5X Mytaq reaction buffer (Bioline, London, UK), 0.2 μl of MyTaq DNA polymerase (Bioline ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell were propogated in either LB or TB media and protein expression was performed by inducing with 0.5 mM IPTG (Isopropyl ß-D-1-thiogalactopyranoside, Bioline, Cat No. BIO-37036) overnight at 180C ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 4 μl of 5X MyTaq reaction buffer (Bioline, London, UK). The amplification products were analyzed by electrophoresis using a 2% agarose gel.
-
bioRxiv - Developmental Biology 2022Quote: ... The PCR was performed using MyTaq polymerase (Bioline; PCR program in Supplementary Table 3). If embryos showed the desired deletions ...
-
bioRxiv - Developmental Biology 2022Quote: ... The PCR was performed using MyTaq polymerase (Bioline; PCR program in Supplementary Table 3). If embryos showed deletions ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was isolated from cells 3 hours after inducing socRNA expression using TRIsure (Bioline). Subsequently ...
-
bioRxiv - Zoology 2019Quote: ... 5’-TAAGCACTTGT CTGTGAAACTGCGA-3’ (Grajales and Rodriguez 2016) with 0.5 U 2x Mango Mix (Bioline), 2 μL of DNA template ...
-
bioRxiv - Plant Biology 2022Quote: ... then resuspended using the vortex in 4 mL of Trisure (Bioline Iberia, Spain) and the lysis was performed after incubation for 5 min at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... Protein expression was induced at an optical density (OD600nm) of 0.8 by adding 50 μM of isopropyl-β-D-a-thiogalactopyranoside (IPTG; Bioline). After 24 h at 13⁰C ...
-
bioRxiv - Immunology 2022Quote: ... 3 µL of 5x PyroTaq EvaGreen qPCR Mix Plus with ROX (Cultek Molecular Bioline, Madrid, Spain), and transcript-specific forward and reverse primers at a 10 μM final concentration ...
-
bioRxiv - Molecular Biology 2020Quote: ... Stain was also added to the markers Hyperladder 1kb™ and Hyperladder 4™ (Bioline) to give final concentrations of 10x and 100x.
-
bioRxiv - Genetics 2020Quote: Separation of the amplified product was accomplished in a 4% (w/v) agarose (Bioline, London) gel in 1% (w/v ...
-
bioRxiv - Cell Biology 2019Quote: ... cells from the transfection without repair plasmid were collected after 3 days for genome extraction (Bioline #BIO-52066) and PCR (NEB #M0491S ...
-
bioRxiv - Plant Biology 2020Quote: ... 3-day-old etiolated hypocotyls or roots were mounted in water under a pad of 0.8% agarose (Bioline). To limit the time that seedlings spent mounted ...
-
bioRxiv - Plant Biology 2021Quote: ... 3-day-old etiolated hypocotyls or roots were mounted in water under a pad of 0.8% agarose (Bioline). To limit the time that seedlings spent mounted ...
-
bioRxiv - Neuroscience 2022Quote: ... using 3 ng of cDNA per reaction and Sensifast SYBR No-ROX mix (Bioline Corporation, Alvinston, ON, Canada). Complementary DNA of mRNA was amplified using a pair of specific forward and reverse primers (Supplementary Table 2) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and insertions were validated as empty/filled and/or by 5’ and 3’ junction PCRs using MyTaq HS DNA polymerase (Bioline). Validation products were run on 1% agarose gels ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The DNA was used as template for PCR amplification of the targeted sites with primers listed on Supplementary Table 3 and using MyTaq™ DNA Polymerase (Bioline). Subsequently ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primers were designed using NCBI primer blast (Table 3) and qRT-PCR was performed using SensiFAST™ SYBR Lo-ROX Kit (#BIO-94020, Bioline) on the BIO-RAD CFX38 Real time PCR machine ...
-
bioRxiv - Microbiology 2021Quote: ... 1:10 dilutions of RNA samples were analyzed using SensiFast SYBR Hi-ROX One-Step kit (Bioline, UK) and 400 nM primer concentrations ...
-
bioRxiv - Immunology 2022Quote: ... using either BIOLASETM polymerase (7×10-5 approximate error/bp) or MyFiTM polymerase (7×10-5 approximate error/bp) both from Bioline (Meridian Bioscience, USA). The PCR mixture consisted of 1X buffer with 1mM dNTP ...
-
bioRxiv - Microbiology 2020Quote: ... The MyTaq One-Step RT-PCR Kit (Bioline) was used to generate and amplify cDNA from viral RNA isolated from nasal wash samples (as above) ...
-
bioRxiv - Cell Biology 2019Quote: ... The amount of M and NA segment was determined with one-step RT-qPCR using SensiFAST™ Probe Lo-ROX One-Step Kit (Bioline). The sequences of primers and probe for M segment detection are AGA TGA GYC TTC TAA CCG AGG TCG (forward primer) ...
-
bioRxiv - Cell Biology 2020Quote: ... Tissue pieces were digested at 4 °C on an orbital shaker-incubator at 200 × rpm (Bioline Global, New South Wales, Australia). After overnight digestion ...
-
bioRxiv - Genomics 2021Quote: ... One-step reverse-transcription quantitative PCR (RT-qPCR) was performed with the SensiFAST™ SYBR® No-ROX One-Step kit (Bioline®) on an Eco™ Real-Time PCR System (Ilumina® ...
-
bioRxiv - Molecular Biology 2024Quote: ... the Methyl Indexed PCR was performed by mixing 4 µL of ligated DNA with x-Gen Dual combinatorial Indexes (IDT) (125 nM final concentration) and MyTaq RedMix (Bioline, BIO-25048) in a final volume of 40 µL ...
-
bioRxiv - Microbiology 2021Quote: ... 125nM) and SensiFAST Probe Hi-ROX One-Step Kit (Bioline) according to the manufacturer’s instructions in a 20μl reaction with 5μl sample ...
-
bioRxiv - Microbiology 2020Quote: ... The Sensi-FAST SYBR Hi-ROX One-Step Kit (Bioline) was used for quantitative real time PCR (qRT-PCR) ...
-
bioRxiv - Genetics 2022Quote: The full exon 3 of PRNP gene (771 bp) of all animals was amplified by PCR using MyTaq™ Red Mix (Bioline Meridian Life Sciences-BIO-25043). Briefly ...
-
bioRxiv - Microbiology 2019Quote: ... A SensiFAST Probe No-ROX One-Step Kit (Bioline, NSW, Australia) was used to carry out the gene expression study following the manufacture’s protocol with a Rotor-gene Q Instrument (Qiagen ...
-
bioRxiv - Physiology 2021Quote: ... was performed with three primers (Figure 1 A, “a”: AAGGCGCATAACGATACCAC, “b”: TACAATGCAGGCTCCAAACAC, “c”: CGAGCACAGGAAGTTCAACA, Eurofins Genomics, Ebersberg/Germany) and the ImmoMix™ kit (Bioline, Cat. No BIO-25020) according to the manufacturer’s instructions.
-
bioRxiv - Pathology 2020Quote: ... were performed using the SensiFAST Probe Lo-ROX One-Step kit (Bioline). The final concentration of primers was 600nM and the probe concentration was 300nM ...
-
bioRxiv - Neuroscience 2024Quote: ... we used the SensiFAST SYBR Lo-ROX one step kit (Bioline, UK) and the ΔΔCt method with GAPDH serving as a housekeeping gene (Reinhardt et al ...
-
bioRxiv - Cell Biology 2023Quote: ... and SensiFAST™ SYBR® No-ROX One-Step Kit (BioLine, BIO-72001). Samples were run in triplicate for each primer set.
-
bioRxiv - Biophysics 2021Quote: Genotyping of ClC-7 KO U2OS clone was performed using an Extract PCR-Kit (Bioline) with the following primers ...
-
bioRxiv - Microbiology 2021Quote: ... 7 μL of SensiMix™ SYBR® Green Master Mix (Bioline®, Memphis, TE, USA), and H20 in a total volume of 15 μL ...
-
bioRxiv - Microbiology 2020Quote: ... qRT-PCR was performed using the SensiFAST SYBR No-ROX One-Step Kit (Bioline) and primers listed in Table S1 ...
-
bioRxiv - Genomics 2022Quote: ... Quantification was carried using SensiFAST™ SYBR® Hi-ROX One-Step Kit (Bioline). Absolute RNA quantification was obtained by interpolating its CT value against the standard curve ...