Labshake search
Citations for Bioline :
101 - 134 of 134 citations for 7H Cyclopenta c pyridin 7 one 5 6 dihydro 3 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... Cells were collected 24 hours after transfection in 5 ml of TRIsure (#BIO-38032; Bioline) and frozen at -80 °C until further processing.
-
bioRxiv - Genetics 2021Quote: ... and then digested with proteinase K (20 μg per sample at 56°C for 2 h; Bioline, cat. # 37084), and electrophoresed on a 1.5% agarose gel to verify that the majority of fragments were 100-400 bp in size ...
-
bioRxiv - Molecular Biology 2023Quote: ... A typical qPCR reaction contained 5 μl 2×SensiFAST SYBR No-Rox mix (Bioline #BIO-98080), 2∼10 ng DNA template ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The DNA was used as template for PCR amplification of the targeted sites with primers listed on Supplementary Table 3 and using MyTaq™ DNA Polymerase (Bioline). Subsequently ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primers were designed using NCBI primer blast (Table 3) and qRT-PCR was performed using SensiFAST™ SYBR Lo-ROX Kit (#BIO-94020, Bioline) on the BIO-RAD CFX38 Real time PCR machine ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 µl of (2x) SYBR green master mix (SensiFAST SYBR kit, Bioline, London, United Kingdom; BIO- 94005) was used and combined with 0.4 µl of a combined forward and reverse primer mix (10 uM of forward and reverse primers in the combined master mix ...
-
bioRxiv - Molecular Biology 2020Quote: ... including 10 μl of 10 mg/ml BSA solution and 5 μl of HyperLadder 1 kb (BIOLINE), 200 μl of the filtered cell lysates was injected onto the pre-equilibrated SEC column ...
-
bioRxiv - Microbiology 2022Quote: ... mutants were selected by PCR screening of colonies grown on LBN + 5% sucrose using Taq polymerase (Bioline) and the primers RSTX_For (5’-GTCACGGGTTGATTGATTCGCAT-3’ ...
-
bioRxiv - Molecular Biology 2021Quote: ... cell lysates were diluted and 5 μl was used for genotyping PCR using MyTaq DNA polymerase (Bioline) with indicated DNA primers ...
-
bioRxiv - Microbiology 2024Quote: ... 4.2 µL of extracted DNA was combined with 5 µL of MyTaq Red polymerase (Bioline, Meridian Bioscience), 0.4 µL of 10 uM forward primer (nexF-N3-6-515f for 16S or nexF-N3-6-ITS1f-KYO1 for ITS) ...
-
bioRxiv - Genetics 2019Quote: ... cDNA was diluted in nuclease-free water and stored at −20°C until used in qPCR with the SensiFastTM SYBR® No-ROX kit (Bioline) and a Lightcycler® 480/1536 (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... Tissue pieces were digested at 4 °C on an orbital shaker-incubator at 200 × rpm (Bioline Global, New South Wales, Australia). After overnight digestion ...
-
bioRxiv - Microbiology 2020Quote: Bacterial cultures were grown in Luria Bertani (LB) broth for 18-24h at 37 °C and DNA was extracted using the Isolate II Genomic DNA Kit (Bioline, UK) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... The hPL-PIPC units were distributed into 45 mL aliquots and stored at −20°C in a freezer (Gram BioLine, Vojens, Denmark). In addition ...
-
bioRxiv - Cancer Biology 2020Quote: The assay consists of 10 μl of reaction volume including 5 ul of 2X buffer (Bioline, Bio-11060), 2 ul of Primer/probe mix in 1xTE with final concentration of 100 nM-600 nM of primers and 50 nM – 500 nM of probes ...
-
bioRxiv - Molecular Biology 2022Quote: ... 30 μl of 86.6% (5:1) diluted MyTaq HotStart Red Mix in water (Bioline, cat. no. BIO-25048) and 10 μl of 1 μM of each primer (TAC0007 and TAC0012 final concentration of 200 nM ...
-
bioRxiv - Cell Biology 2020Quote: ... Then 5 μg of the extracted RNA was reversely transcribed by utilizing Tetro cDNA Synthesis Kit (Bioline, BIO-65043) and random Hexamer Primer according to the manufacturer’s protocols ...
-
bioRxiv - Molecular Biology 2019Quote: ... 15 pmol of each forward primer 341F 5’-NNNNNNNNNNTCCTACGGGNGGCWGCAG and reverse primer 785R 5’-NNNNNNNNNNTGACTACHVGGGTATCTAAKCC in 20 μL volume of 1 x MyTaq buffer containing 1.5 units MyTaq DNA polymerase (Bioline) and 2 μl of BioStabII PCR Enhancer (Sigma) ...
-
bioRxiv - Microbiology 2019Quote: ... with total reaction volume of 10 μl containing 5 μl Rotor-Gene SYBR® Green PCR Kit (Bioline, Australia), 0.3 μl each of 10 μM forward and reverse primer and 2 μl of genomic DNA ...
-
bioRxiv - Genetics 2020Quote: ... 1 μl forward and reverse primers (10 mM) and 0.5 μl (5 U/μl) BioTaq DNA polymerase (Bioline, London) and amplified using PCR thermal cycler (BiometraTOne ...
-
bioRxiv - Molecular Biology 2021Quote: ... Each sample was measured in triplicate of 5 μl with the following final concentrations: Velocity Polymerase 0.6 U (Bioline), 1.2 x Hifi Buffer (Bioline) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4.2 µL purified DNA from chromatin immunoprecipitation was mixed with 5 µL 2x SensiFAST SYBR No-ROX kit (Bioline) and 0.4 µL forward and reverse primer (10 µM) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2.5 µl of 1:10 diluted cDNA was added to 7.5 µl of Sensi-FAST SYBR No-ROX (Bioline) and 400 nM of forward and reverse primers in a 15 µl final volume ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2.5 µl of 1:10 diluted cDNA was added to 7.5 µl of Sensi-FAST SYBR No-ROX (Bioline) and 400 nM of forward and reverse primers in a 15 µl final volume ...
-
bioRxiv - Microbiology 2021Quote: RNA from GP barley infected with Fg-IFA65 at 5 dpi and an uninfected control was extracted with the Isolate II plant miRNA kit (Bioline). 1 µg of RNA (>200 nt ...
-
bioRxiv - Molecular Biology 2020Quote: ... qPCRs were run using 2 µl cDNA (diluted 1:1) in a 10 µl reaction with 5 µl SensiFAST SBYR No-ROX Kit (Bioline) and 0.1 µM of each primer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Isolated RNA (0.5-1 µg) was then used for reverse transcription into first strand cDNA via a SensiFast cDNA synthesis kit (Bioline). RNA spike I (TATAA ...
-
bioRxiv - Microbiology 2023Quote: ... The reactions (10 μL total volume) contained 5 μL of 2 × SensiFAST™ SYBR No-ROX Kit (Bioline, London, UK), 0.2 μM of each arsM gene primer ...
-
bioRxiv - Physiology 2021Quote: ... was performed with three primers (Figure 1 A, “a”: AAGGCGCATAACGATACCAC, “b”: TACAATGCAGGCTCCAAACAC, “c”: CGAGCACAGGAAGTTCAACA, Eurofins Genomics, Ebersberg/Germany) and the ImmoMix™ kit (Bioline, Cat. No BIO-25020) according to the manufacturer’s instructions.
-
bioRxiv - Genetics 2022Quote: The full exon 3 of PRNP gene (771 bp) of all animals was amplified by PCR using MyTaq™ Red Mix (Bioline Meridian Life Sciences-BIO-25043). Briefly ...
-
bioRxiv - Cancer Biology 2019Quote: ... cDNA was amplified on quantitative PCR in a total volume of 5 μl with SensiFAST SYBR® No-ROX Kit (Bioline) and specific primers on a LightCycler 480 (Roche) ...
-
bioRxiv - Zoology 2022Quote: We set up 50 μl PCR reactions using 2.5 μl template DNA and 47.5 μl PCR mastermix made from 5 μl of 10× OptiBuffer (Bioline Reagents Ltd, UK), 2.5 μl of primer at 10 μM ...
-
bioRxiv - Physiology 2021Quote: ... the K13 locus was amplified directly from whole blood using the primer pair p26+p27 (Supplementary file 5) and the MyTaq™ Blood-PCR Kit (Bioline). Primer pairs p39+p40 and p50+p51 were used to amplify fd and mdr2 ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were prepared for qPCR in technical triplicates in 5 µL reaction volumes using SensiFAST SYBR Lo-ROX 2X master mix (Bioline; Cat. No. BIO-94005), custom qPCR primers from Integrated DNA Technologies used at a final concentration of 0.2 µM ...