Labshake search
Citations for Bioline :
151 - 162 of 162 citations for 7 Methylimidazo 1 2 a pyridine 6 boronic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Isolated RNA (0.5-1 µg) was then used for reverse transcription into first strand cDNA via a SensiFast cDNA synthesis kit (Bioline). RNA spike I (TATAA ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... 20 µl of the epPCR served as a template for a second 1 ml standard PCR with 25 cycles using BioTaq polymerase (Bioline) and primers CW1&2 as previously described49 ...
-
bioRxiv - Microbiology 2021Quote: ... Each reaction (20 μL) consisted of 1 μL of cDNA substrate and 19 μL of a SensiFAST No-ROX Kit Master Mix (Bioline, UK). Following primer optimisation ...
-
bioRxiv - Developmental Biology 2020Quote: cDNA was diluted 1:10 in nuclease-free water and subsequently applied for qRT-PCR using the SensiFast™SYBR HiROX Kit (Bioline) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... and 1 μL of the obtained cDNA was used for real-time PCR with SYBR™ green master mix (Bioline, Luckenwalde, Germany) on a C1000 Touch™ Thermal Cycler (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 ng of the total RNA was reverse-transcribed into cDNA using a Tetro cDNA synthesis kit (BIO-65042, Bioline, London, UK). Quantitative PCR (RT-qPCR ...
-
bioRxiv - Plant Biology 2023Quote: ... A total of 1 µg of total RNA was used to initiate cDNA synthesis using the SensiFAST™ cDNA Synthesis Kit (Bioline, London, UK). The SYBR Green assay with SensiFAST™ SYBR no ROX kit was used for the quantification of transcripts in RT-PCR ...
-
bioRxiv - Genetics 2022Quote: ... The Endpoint PCR amplification (gDNA concentration of 20-50 ng μl−1 per sample) for each target region were performed using MyFi™ DNA Polymerase Kit (Bioline GmbH, Luckenwalde, Germany) and specific primers (IDENTXX GmbH)in a PCR thermal cycler (T100 PCR thermal cycler ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell were propogated in either LB or TB media and protein expression was performed by inducing with 0.5 mM IPTG (Isopropyl ß-D-1-thiogalactopyranoside, Bioline, Cat No. BIO-37036) overnight at 180C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... from Mediterranean and temperate species had germinated we transplanted up to 20 seedlings each into 9 × 9 cm pots (one plant per pot) with a 3:1 mixture of potting soil (Einheitserde®, BioLine, Topfsubstrat Öko torffrei) and sand (0-2 mm play sand ...
-
bioRxiv - Microbiology 2020Quote: ... 2uL of the DNA extracted from sputum samples was used as a template in 20-mL qPCR reactions containing 1× SensiFAST™ Probe Hi-ROX (Bioline, Cat. No. BIO-82020), 200 nM probe ...
-
bioRxiv - Physiology 2021Quote: ... was performed with three primers (Figure 1 A, “a”: AAGGCGCATAACGATACCAC, “b”: TACAATGCAGGCTCCAAACAC, “c”: CGAGCACAGGAAGTTCAACA, Eurofins Genomics, Ebersberg/Germany) and the ImmoMix™ kit (Bioline, Cat. No BIO-25020) according to the manufacturer’s instructions.