Labshake search
Citations for Bioline :
1 - 50 of 184 citations for 6 Methyl 3 4 dihydro 2H pyrido 3 2 b 1 4 oxazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2024Quote: ... then incubated overnight at 37°C with staining buffer (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside [X-gal, Bioline, London ...
-
bioRxiv - Genetics 2020Quote: ... 4 mM MgCl2 (Bioline); 800nM dNTPs (Bioline) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 mM MgCl (Bioline, Boston, MA), 1 mM dNTP (Bioline ...
-
bioRxiv - Molecular Biology 2023Quote: ... This cDNA library was then PCR barcoded with PCR Primer 1.0 (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG-3’) and a sample-specific barcode primer (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTG-3’) using MyTaq Red Mix (Bioline) for 15 cycles ...
-
bioRxiv - Genetics 2023Quote: ... An 800–base pair region surrounding the target site of the Cypor sgRNA was amplified (forward primer 5′-GTTTGCGGGTGTTAGCTCTTC-3′; reverse primer 5′-TTGGTGGGTAAATCACACCGT-3′) using MyTaq Red Mix (Bioline). The amplicon was purified using the PCR clean-up and gel extraction kit (Macherey-Nagel ...
-
bioRxiv - Cell Biology 2020Quote: ... subsequently diluted in water (1:4) and mixed with SensiFAST SYBR Hi-Rox (Bioline) and the appropriate primers at a final concentration of 10 μM ...
-
bioRxiv - Microbiology 2021Quote: ... and 3 μL of Proteinase K (20 mg/ mL, Bioline Australia Pty Ltd ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... and 3 μL of Proteinase K (20 mg/ mL, Bioline Australia Pty Ltd ...
-
bioRxiv - Neuroscience 2022Quote: ... Dehydrated samples were rehydrated through a series of methanol/PBS washes for 10 minutes each at room temperature with an additional 3 x 10 minutes PBSTw (0.1% Tween-20) and treated with proteinase K (1:1000, Bioline) for 20 minutes to increase permeabilization ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μl of 5X Mytaq reaction buffer (Bioline, London, UK), 0.2 μl of MyTaq DNA polymerase (Bioline ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 4 μl of 5X MyTaq reaction buffer (Bioline, London, UK). The amplification products were analyzed by electrophoresis using a 2% agarose gel.
-
bioRxiv - Neuroscience 2019Quote: A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...
-
bioRxiv - Developmental Biology 2022Quote: ... The PCR was performed using MyTaq polymerase (Bioline; PCR program in Supplementary Table 3). If embryos showed the desired deletions ...
-
bioRxiv - Developmental Biology 2022Quote: ... The PCR was performed using MyTaq polymerase (Bioline; PCR program in Supplementary Table 3). If embryos showed deletions ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was isolated from cells 3 hours after inducing socRNA expression using TRIsure (Bioline). Subsequently ...
-
bioRxiv - Zoology 2019Quote: ... 5’-TAAGCACTTGT CTGTGAAACTGCGA-3’ (Grajales and Rodriguez 2016) with 0.5 U 2x Mango Mix (Bioline), 2 μL of DNA template ...
-
bioRxiv - Plant Biology 2022Quote: ... then resuspended using the vortex in 4 mL of Trisure (Bioline Iberia, Spain) and the lysis was performed after incubation for 5 min at room temperature ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... from Mediterranean and temperate species had germinated we transplanted up to 20 seedlings each into 9 × 9 cm pots (one plant per pot) with a 3:1 mixture of potting soil (Einheitserde®, BioLine, Topfsubstrat Öko torffrei) and sand (0-2 mm play sand ...
-
bioRxiv - Immunology 2022Quote: ... 3 µL of 5x PyroTaq EvaGreen qPCR Mix Plus with ROX (Cultek Molecular Bioline, Madrid, Spain), and transcript-specific forward and reverse primers at a 10 μM final concentration ...
-
bioRxiv - Molecular Biology 2020Quote: ... Stain was also added to the markers Hyperladder 1kb™ and Hyperladder 4™ (Bioline) to give final concentrations of 10x and 100x.
-
bioRxiv - Genetics 2020Quote: Separation of the amplified product was accomplished in a 4% (w/v) agarose (Bioline, London) gel in 1% (w/v ...
-
bioRxiv - Cell Biology 2019Quote: ... cells from the transfection without repair plasmid were collected after 3 days for genome extraction (Bioline #BIO-52066) and PCR (NEB #M0491S ...
-
bioRxiv - Plant Biology 2020Quote: ... 3-day-old etiolated hypocotyls or roots were mounted in water under a pad of 0.8% agarose (Bioline). To limit the time that seedlings spent mounted ...
-
bioRxiv - Plant Biology 2021Quote: ... 3-day-old etiolated hypocotyls or roots were mounted in water under a pad of 0.8% agarose (Bioline). To limit the time that seedlings spent mounted ...
-
bioRxiv - Neuroscience 2022Quote: ... using 3 ng of cDNA per reaction and Sensifast SYBR No-ROX mix (Bioline Corporation, Alvinston, ON, Canada). Complementary DNA of mRNA was amplified using a pair of specific forward and reverse primers (Supplementary Table 2) ...
-
bioRxiv - Genomics 2020Quote: ... 2 □1 water and 5□1 MyTaq™ HS Mix (Bioline). RT-PCR was performed in the following conditions ...
-
bioRxiv - Molecular Biology 2022Quote: ... and insertions were validated as empty/filled and/or by 5’ and 3’ junction PCRs using MyTaq HS DNA polymerase (Bioline). Validation products were run on 1% agarose gels ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The DNA was used as template for PCR amplification of the targeted sites with primers listed on Supplementary Table 3 and using MyTaq™ DNA Polymerase (Bioline). Subsequently ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primers were designed using NCBI primer blast (Table 3) and qRT-PCR was performed using SensiFAST™ SYBR Lo-ROX Kit (#BIO-94020, Bioline) on the BIO-RAD CFX38 Real time PCR machine ...
-
bioRxiv - Cell Biology 2020Quote: ... Tissue pieces were digested at 4 °C on an orbital shaker-incubator at 200 × rpm (Bioline Global, New South Wales, Australia). After overnight digestion ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL 1:1 diluted cDNA and SensiFAST SYBR No-ROX Kit (#BIO-98005, Bioline). Knockdown was assessed using ΔΔCt analysis as described by Pfaffl [92].
-
bioRxiv - Molecular Biology 2024Quote: ... the Methyl Indexed PCR was performed by mixing 4 µL of ligated DNA with x-Gen Dual combinatorial Indexes (IDT) (125 nM final concentration) and MyTaq RedMix (Bioline, BIO-25048) in a final volume of 40 µL ...
-
bioRxiv - Genetics 2022Quote: The full exon 3 of PRNP gene (771 bp) of all animals was amplified by PCR using MyTaq™ Red Mix (Bioline Meridian Life Sciences-BIO-25043). Briefly ...
-
bioRxiv - Immunology 2022Quote: ... DNA amplifications for the conTRT amplicons were performed similarly except Ranger DNA polymerase (1×10-6 approximate error/bp) from Bioline was utilized ...
-
bioRxiv - Microbiology 2022Quote: ... 6 μl MyTaq Red DNA polymerase Mix (BioLine) and 1 μl of each primer (10 μmol) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... each well contained 1 mL LB agar supplemented with 2 mM IPTG (Bioline), 5 μg/mL chloramphenicol (MilliporeSigma) ...
-
bioRxiv - Physiology 2021Quote: ... was performed with three primers (Figure 1 A, “a”: AAGGCGCATAACGATACCAC, “b”: TACAATGCAGGCTCCAAACAC, “c”: CGAGCACAGGAAGTTCAACA, Eurofins Genomics, Ebersberg/Germany) and the ImmoMix™ kit (Bioline, Cat. No BIO-25020) according to the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2020Quote: ... 2 μl of 1:10 diluted cDNA and BIOTAQ™ DNA polymerase (Bioline GmbH) were used in a CFX96™ Real-Time PCR Detection System (Bio-Rad Laboratories ...
-
bioRxiv - Molecular Biology 2020Quote: ... qPCRs were run using 2 µl cDNA (diluted 1:1) in a 10 µl reaction with 5 µl SensiFAST SBYR No-ROX Kit (Bioline) and 0.1 µM of each primer ...
-
bioRxiv - Biochemistry 2020Quote: ... 2’dUTP and 2’dCTP were from Bioline Reagents (London ...
-
bioRxiv - Evolutionary Biology 2022Quote: Electrophoresis of the Round 2 Multiplex-Nested-PCR product was performed on a 1% agarose (Molecular grade, Bioline) gel ...
-
bioRxiv - Developmental Biology 2019Quote: ... 0.4 μM zebrafish genotyping primers (Extended Data Fig.5A, Table 2) and 1 x MyTaq Red DNA Polymerase (Bioline) according to the manufacturer’s protocol in a T100 thermal cycler ...
-
Safety and efficacy of C9ORF72-repeat RNA nuclear export inhibition in amyotrophic lateral sclerosisbioRxiv - Systems Biology 2021Quote: ... 1 µg RNA (iNeurons samples) or 2 µg RNA (Drosophila samples) was converted to cDNA using BioScript Reverse Transcriptase (Bioline). qRT–PCR primers were designed using Origene or Primer-BLAST and validated using a 1 in 4 serial template dilution series (standard curve with R2>0.97) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... qRT-PCR was carried out on 1:2 diluted cDNA on an Applied Biosystems StepOnePlus system using a Sensifast Hi-Rox SYBR kit (Bioline). Cycle conditions were as follows ...
-
bioRxiv - Immunology 2023Quote: RNA was extracted from a total of 106 B cells purified from spleen or lymph nodes or 105 B cells sorted from the B:T co-cultures (72 h) using TRIsure™ (Bioline) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... A CCDC26 exon 6 DNA template was generated by performing a PCR using Red Mix (Bioline, Cat. No. BIO25043) WT K562 cDNA and CCDC26-specific primers that incorporated a T7 RNA polymerase promoter at the 5’-end of the DNA strand to be later transcribed (Supplementary Table 1) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.25uM forward and reverse oligo primers (see supplementary table 6) and SensiFAST SYBR Hi-ROX Kit (Bioline, BIO-92005) in 384-well plates with the LightCycler 480 Instrument II (Roche ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 2 μL of MyTaq™ 5x reaction buffer (Bioline), 0.08 μL of each primers ...
-
bioRxiv - Microbiology 2021Quote: ... and 2× My Taq Red (Bioline, Taunton, MA, USA). The PCR conditions were as follows ...
-
bioRxiv - Synthetic Biology 2022Quote: ... LB medium was supplemented with 2 mM IPTG (Bioline), 5 μg/mL chloramphenicol (MilliporeSigma) ...