Labshake search
Citations for Bioline :
1 - 50 of 73 citations for 6 Chloro 9 2 C methyl β D riboFuranosyl 9H purine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2024Quote: ... then incubated overnight at 37°C with staining buffer (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside [X-gal, Bioline, London ...
-
bioRxiv - Microbiology 2020Quote: ... Protein expression was induced at an optical density (OD600nm) of 0.8 by adding 50 μM of isopropyl-β-D-a-thiogalactopyranoside (IPTG; Bioline). After 24 h at 13⁰C ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1.0% (wt/vol) DNase (Bioline, 9003-98-9) in calcium- and magnesium-free 1X HBSS (Gibco ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... from Mediterranean and temperate species had germinated we transplanted up to 20 seedlings each into 9 × 9 cm pots (one plant per pot) with a 3:1 mixture of potting soil (Einheitserde®, BioLine, Topfsubstrat Öko torffrei) and sand (0-2 mm play sand ...
-
bioRxiv - Genetics 2021Quote: ... and then digested with proteinase K (20 μg per sample at 56°C for 2 h; Bioline, cat. # 37084), and electrophoresed on a 1.5% agarose gel to verify that the majority of fragments were 100-400 bp in size ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA synthesis was performed with 0.25-1 µg of RNA in a 20 µL total reaction volume using a random hexamer/oligo dT strand synthesis kit as per the manufacturer’s instructions (10 min at 25°C; 15 min at 42°C; 15 min at 48°C; SensiFast, Bioline). All oligonucleotide sequences are listed in Table 1.
-
bioRxiv - Microbiology 2020Quote: ... and cDNA synthesized with 0.25-1μg of RNA in a 20μL total reaction volume using a random hexamer/oligo dT strand synthesis kit in accordance with the manufacturer’s instructions (10 minutes at 25°C; 15 minutes at 42°C; 15 minutes at 48°C; SensiFast, Bioline). PCR amplification of HBV RNAs were performed using primers as previously described43 using a SYBR green real-time PCR protocol (qPCRBIO SyGreen ...
-
bioRxiv - Microbiology 2022Quote: ... 6 μl MyTaq Red DNA polymerase Mix (BioLine) and 1 μl of each primer (10 μmol) ...
-
bioRxiv - Genetics 2020Quote: ... CpGs 4-8 (F– TTTAGTAGAGGAAATAAAATAGTAGAAAAA-Biotinylated; R: CCCCAAAAAACCACAAAACCTA) CpGs 9-11 (F – GGATGGAGGAATTTTTTTGTGTT; R: CCCCAAAAAACCACAAAACCTA -Biotinylated) using MyTaq HS mix PCR reagents (Bioline). Amplicons were processed on the Qiagen Q24 Workstation and sequenced in duplicate on the Qiagen Q24 pyrosequencer using the sequencing primers CpGs 4-8 (AACAATTTAAACAAAAAATAACATT ...
-
bioRxiv - Biochemistry 2020Quote: ... 2’dUTP and 2’dCTP were from Bioline Reagents (London ...
-
bioRxiv - Genomics 2023Quote: ... 1’ 72°C) by MyTaq Red mix (Bioline) using primers that add overhangs with EcoRI (MT024 ...
-
bioRxiv - Plant Biology 2021Quote: ... cDNA synthesis was performed using an oligo d(T) primer and Tetro Reverse Transcriptase (Bioline). We performed qRT-PCR using the primers in Supplemental Table 1 and SYBR green supermix ...
-
bioRxiv - Cell Biology 2021Quote: ... The interaction between the protein products fused to the DNA binding and activation domains were analyzed by the activity of β-galactosidase by the cleavage of X-Gal (BIO-37035, Bioline, UK). For detecting the β-galactosidase activity overlaying of low melting agarose with X-Gal (over lay mix was prepared freshly) ...
-
bioRxiv - Molecular Biology 2020Quote: ... A CCDC26 exon 6 DNA template was generated by performing a PCR using Red Mix (Bioline, Cat. No. BIO25043) WT K562 cDNA and CCDC26-specific primers that incorporated a T7 RNA polymerase promoter at the 5’-end of the DNA strand to be later transcribed (Supplementary Table 1) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.25uM forward and reverse oligo primers (see supplementary table 6) and SensiFAST SYBR Hi-ROX Kit (Bioline, BIO-92005) in 384-well plates with the LightCycler 480 Instrument II (Roche ...
-
bioRxiv - Genomics 2020Quote: ... at 37°C for 30 min and then proteinase K digestion (Bioline, cat. #37084) for 2 h at 56 °C ...
-
bioRxiv - Genomics 2023Quote: ... for 1 hour at 37°C and proteinase K (40 ug, Bioline BIO-37084) for 2 hours at 55°C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 2 μL of MyTaq™ 5x reaction buffer (Bioline), 0.08 μL of each primers ...
-
bioRxiv - Microbiology 2021Quote: ... and 2× My Taq Red (Bioline, Taunton, MA, USA). The PCR conditions were as follows ...
-
bioRxiv - Synthetic Biology 2022Quote: ... LB medium was supplemented with 2 mM IPTG (Bioline), 5 μg/mL chloramphenicol (MilliporeSigma) ...
-
bioRxiv - Immunology 2022Quote: ... DNA amplifications for the conTRT amplicons were performed similarly except Ranger DNA polymerase (1×10-6 approximate error/bp) from Bioline was utilized ...
-
bioRxiv - Genomics 2019Quote: ... pool C was diluted 1,000-fold and 1.5 fmol were amplified using VELOCITY DNA polymerase (Bioline) with forward primer pool-FP1 and reverse primer pool-RP2 using the following PCR conditions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Quantitative RT-PCR was performed using SensiMix SYBR Low-ROX Kit (Bioline; annealing temperature – 60°C) in a Lightcycler 480 384-well plate (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... The resulting PCR products from slurry and syringe method control samples were purified as follows: 30 μl of PCR product per sample was mixed with 6 μl 5X loading dye (Bioline, London, UK) and separated using a 1.5% agarose gel stained with SYBR Safe DNA gel stain (Invitrogen ...
-
bioRxiv - Genomics 2020Quote: ... 2 □1 water and 5□1 MyTaq™ HS Mix (Bioline). RT-PCR was performed in the following conditions ...
-
bioRxiv - Genomics 2022Quote: ... and run on a 2% agarose gel (Bioline, Cat#: BIO-41025) pre-stained with SYBR Safe Nucleic Acid Gel Stain (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products visualized by electrophoresis on 2% agarose (Bioline, London, UK) gel stained with SYBR Safe (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cross-linking was reversed by overnight incubation at 60°C with proteinase K (Bioline, Lot # BIO-37037). Then 3C libraries were purified by phenol-chloroform followed by chloroform extraction and ethanol-precipitated at −80°C overnight ...
-
bioRxiv - Microbiology 2019Quote: ... for 14 hours at 37 °C in the presence of RiboSafe RNAse Inhibitor (Bioline, cat. number BIO-65028). Next ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell were propogated in either LB or TB media and protein expression was performed by inducing with 0.5 mM IPTG (Isopropyl ß-D-1-thiogalactopyranoside, Bioline, Cat No. BIO-37036) overnight at 180C ...
-
bioRxiv - Neuroscience 2020Quote: ... 20 μl of digest were run on 2 % agarose gel (BIOLINE, London, UK) and imaged on a trans illuminator ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR reactions were set up using SensiFast 2× Mastermix (Bioline Cat# BIO-94020) and oligonucleotides targeting genes of interest (IDT ...
-
bioRxiv - Neuroscience 2020Quote: ... qRT-PCR was performed using the 2× SYBR Green PCR Master Mix (Bioline) with the CFX96 detection system and analyzed with CFX Manager softward (Bio-rad) ...
-
bioRxiv - Genomics 2022Quote: ... PCR products were run on 0.8-2% agarose gels (Bioline, Cat#: BIO-41025), depending on fragment size ...
-
bioRxiv - Plant Biology 2020Quote: ... The digested product was visualized on a 2% (w/v) agarose gel (Bioline) by electrophoresis at 90 V for 90 min and the genotype of each line at the SNP position was confirmed according to the product bands on the gel ...
-
bioRxiv - Synthetic Biology 2022Quote: ... each well contained 1 mL LB agar supplemented with 2 mM IPTG (Bioline), 5 μg/mL chloramphenicol (MilliporeSigma) ...
-
bioRxiv - Genomics 2023Quote: ... 25 μL 2 x MyTaq HS Red Mix (Bioline, cat. no. BIO-25048), and plate-specific Illumina PCR indexed primers (TAC0012 and TAC0007 ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR products were separated by gel electrophoresis on 2% DNA grade agarose (Bioline) gels in TAE buffer (40 mM Tris Acetate ...
-
bioRxiv - Plant Biology 2020Quote: ... 2 μl of 1:10 diluted cDNA and BIOTAQ™ DNA polymerase (Bioline GmbH) were used in a CFX96™ Real-Time PCR Detection System (Bio-Rad Laboratories ...
-
bioRxiv - Genetics 2019Quote: ... cDNA was diluted in nuclease-free water and stored at −20°C until used in qPCR with the SensiFastTM SYBR® No-ROX kit (Bioline) and a Lightcycler® 480/1536 (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... Tissue pieces were digested at 4 °C on an orbital shaker-incubator at 200 × rpm (Bioline Global, New South Wales, Australia). After overnight digestion ...
-
bioRxiv - Microbiology 2020Quote: Bacterial cultures were grown in Luria Bertani (LB) broth for 18-24h at 37 °C and DNA was extracted using the Isolate II Genomic DNA Kit (Bioline, UK) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 2 μL of diluted cDNA were combined with 5 μL SYBR Green (Bioline, Luckenwalde, Germany), 0.2 μL of each forward and reverse primer and 4.6 μL DEPC-water ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL 1:1 diluted cDNA and SensiFAST SYBR No-ROX Kit (#BIO-98005, Bioline). Knockdown was assessed using ΔΔCt analysis as described by Pfaffl [92].
-
bioRxiv - Cell Biology 2019Quote: ... The hPL-PIPC units were distributed into 45 mL aliquots and stored at −20°C in a freezer (Gram BioLine, Vojens, Denmark). In addition ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 µg of total RNA was used to prepare cDNA with SensiFast cDNA synthesis kit (Bioline) according to the manufacturer’s instructions and diluted 1:6 with DNAse/RNAse-free water (Thermo Fisher ...
-
bioRxiv - Plant Biology 2021Quote: ... Each 20 μL reaction consisted of 10 μL of SensiFAST Probe No-ROX Mix (2×) (Bioline), 0.25 μM each of RamF6 and RamR6 primers (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 RNA was converted to cDNA using the SensiFAST cDNA kit (#BIO-65053, BioLine) with 10 μL of RNA extract per reaction following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... A typical qPCR reaction contained 5 μl 2×SensiFAST SYBR No-Rox mix (Bioline #BIO-98080), 2∼10 ng DNA template ...
-
bioRxiv - Genomics 2023Quote: ... PCR2 was performed using 15 μL 2 x MyTaq Red Mix (Bioline, cat. no. BIO-25044) and 5 μL of each PCR1 product with well-specific Illumina PCR indexed primers (TAC0159 & TAC0009 ...