Labshake search
Citations for Bioline :
1 - 50 of 107 citations for 6 Bromo 2 trifluoromethyl 3H imidazo 4 5 b pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2024Quote: ... then incubated overnight at 37°C with staining buffer (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside [X-gal, Bioline, London ...
-
bioRxiv - Genomics 2020Quote: ... 2 □1 water and 5□1 MyTaq™ HS Mix (Bioline). RT-PCR was performed in the following conditions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 2 μL of diluted cDNA were combined with 5 μL SYBR Green (Bioline, Luckenwalde, Germany), 0.2 μL of each forward and reverse primer and 4.6 μL DEPC-water ...
-
bioRxiv - Neuroscience 2019Quote: A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... A typical qPCR reaction contained 5 μl 2×SensiFAST SYBR No-Rox mix (Bioline #BIO-98080), 2∼10 ng DNA template ...
-
bioRxiv - Molecular Biology 2020Quote: ... qPCRs were run using 2 µl cDNA (diluted 1:1) in a 10 µl reaction with 5 µl SensiFAST SBYR No-ROX Kit (Bioline) and 0.1 µM of each primer ...
-
bioRxiv - Microbiology 2023Quote: ... The reactions (10 μL total volume) contained 5 μL of 2 × SensiFAST™ SYBR No-ROX Kit (Bioline, London, UK), 0.2 μM of each arsM gene primer ...
-
bioRxiv - Microbiology 2022Quote: ... 6 μl MyTaq Red DNA polymerase Mix (BioLine) and 1 μl of each primer (10 μmol) ...
-
bioRxiv - Genetics 2020Quote: ... 4 mM MgCl2 (Bioline); 800nM dNTPs (Bioline) ...
-
bioRxiv - Biochemistry 2020Quote: ... 2’dUTP and 2’dCTP were from Bioline Reagents (London ...
-
bioRxiv - Immunology 2023Quote: RNA was extracted from a total of 106 B cells purified from spleen or lymph nodes or 105 B cells sorted from the B:T co-cultures (72 h) using TRIsure™ (Bioline) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... with a 5μL 5 HyperLadderTM 100bp (Bioline) to confirm product size ...
-
bioRxiv - Molecular Biology 2023Quote: ... This cDNA library was then PCR barcoded with PCR Primer 1.0 (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG-3’) and a sample-specific barcode primer (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTG-3’) using MyTaq Red Mix (Bioline) for 15 cycles ...
-
bioRxiv - Genetics 2023Quote: ... An 800–base pair region surrounding the target site of the Cypor sgRNA was amplified (forward primer 5′-GTTTGCGGGTGTTAGCTCTTC-3′; reverse primer 5′-TTGGTGGGTAAATCACACCGT-3′) using MyTaq Red Mix (Bioline). The amplicon was purified using the PCR clean-up and gel extraction kit (Macherey-Nagel ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μl of 5X Mytaq reaction buffer (Bioline, London, UK), 0.2 μl of MyTaq DNA polymerase (Bioline ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were set up in total volumes of 10 µl each, containing 5× MyTaq reaction buffer (5 mM dNTPs, 15 mM MgCl2, stabilizers and enhancers) (Bioline, London, UK), 2 µM of each primer ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... consisting of 5 μL MyTaq HS DNA Polymerase (Bioline), 0.2 μL of each forward and reverse primer ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 μl of 2x SYBR green master mix (Bioline), 1μl (5 pmol/μl ...
-
bioRxiv - Plant Biology 2023Quote: ... and 5-µL of SensiFAST SYBR & Fluorescein Kit (Bioline). Each sample was measured in triplicate ...
-
bioRxiv - Immunology 2022Quote: ... using either BIOLASETM polymerase (7×10-5 approximate error/bp) or MyFiTM polymerase (7×10-5 approximate error/bp) both from Bioline (Meridian Bioscience, USA). The PCR mixture consisted of 1X buffer with 1mM dNTP ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 4 μl of 5X MyTaq reaction buffer (Bioline, London, UK). The amplification products were analyzed by electrophoresis using a 2% agarose gel.
-
bioRxiv - Physiology 2021Quote: ... was performed with three primers (Figure 1 A, “a”: AAGGCGCATAACGATACCAC, “b”: TACAATGCAGGCTCCAAACAC, “c”: CGAGCACAGGAAGTTCAACA, Eurofins Genomics, Ebersberg/Germany) and the ImmoMix™ kit (Bioline, Cat. No BIO-25020) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2020Quote: ... A CCDC26 exon 6 DNA template was generated by performing a PCR using Red Mix (Bioline, Cat. No. BIO25043) WT K562 cDNA and CCDC26-specific primers that incorporated a T7 RNA polymerase promoter at the 5’-end of the DNA strand to be later transcribed (Supplementary Table 1) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.25uM forward and reverse oligo primers (see supplementary table 6) and SensiFAST SYBR Hi-ROX Kit (Bioline, BIO-92005) in 384-well plates with the LightCycler 480 Instrument II (Roche ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 2 μL of MyTaq™ 5x reaction buffer (Bioline), 0.08 μL of each primers ...
-
bioRxiv - Microbiology 2021Quote: ... and 2× My Taq Red (Bioline, Taunton, MA, USA). The PCR conditions were as follows ...
-
bioRxiv - Synthetic Biology 2022Quote: ... LB medium was supplemented with 2 mM IPTG (Bioline), 5 μg/mL chloramphenicol (MilliporeSigma) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 5 μl of 2X SensiFAST SYBR No-ROX kit (Bioline) in a 10 μl total volume ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and 2.5-5 μL of Proteinase K (20 mg/mL, Bioline Australia Pty Ltd ...
-
bioRxiv - Microbiology 2021Quote: ... using 5 μl product with 1 μl 5X loading dye (BioLine) to verify bands of approximately 450 bp ...
-
bioRxiv - Genetics 2021Quote: ... 0.125 μL IMMOLASE™ DNA Polymerase (5 u/μL) (Bioline (Aust) Pty Ltd ...
-
bioRxiv - Genomics 2022Quote: ... Each reaction contained 5 μl SensiFAST 1x LoRox SYBR Mix (Bioline), 0.25 μl forward primer (10 μM) ...
-
bioRxiv - Immunology 2022Quote: ... DNA amplifications for the conTRT amplicons were performed similarly except Ranger DNA polymerase (1×10-6 approximate error/bp) from Bioline was utilized ...
-
bioRxiv - Plant Biology 2022Quote: ... then resuspended using the vortex in 4 mL of Trisure (Bioline Iberia, Spain) and the lysis was performed after incubation for 5 min at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... and IMMOLASETM DNA polymerase (5 U/μl) (Bioline; Cat. No. BIO-21047) as described by Lee et al ...
-
bioRxiv - Immunology 2020Quote: ... 5 - 10 ng DNA was used for amplification with MyTaq Polymerase (Bioline). The PCR cycling conditions were as follows ...
-
bioRxiv - Microbiology 2022Quote: ... and IMMOLASETM DNA polymerase (5 U/μl) (Bioline; Cat. No. BIO-21047) as described by Lee et al ...
-
bioRxiv - Microbiology 2021Quote: ... 1% SDS (Sigma-Aldrich)] supplemented with 5 μL Proteinase K (20 mg mL−1; Bioline Australia) to lyse cells ...
-
bioRxiv - Cell Biology 2020Quote: ... subsequently diluted in water (1:4) and mixed with SensiFAST SYBR Hi-Rox (Bioline) and the appropriate primers at a final concentration of 10 μM ...
-
bioRxiv - Microbiology 2021Quote: ... The resulting PCR products from slurry and syringe method control samples were purified as follows: 30 μl of PCR product per sample was mixed with 6 μl 5X loading dye (Bioline, London, UK) and separated using a 1.5% agarose gel stained with SYBR Safe DNA gel stain (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... and run on a 2% agarose gel (Bioline, Cat#: BIO-41025) pre-stained with SYBR Safe Nucleic Acid Gel Stain (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products visualized by electrophoresis on 2% agarose (Bioline, London, UK) gel stained with SYBR Safe (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... Each 100 μl PCR reaction contained 5 U MyTaq DNA polymerase (Bioline, Australia), 1 × MyTaq reaction buffer ...
-
bioRxiv - Microbiology 2021Quote: ... and IMMOLASE™ DNA polymerase (5 U/μl) (Bioline; Cat. No. BIO-21047) as described by Lee et al ...
-
bioRxiv - Molecular Biology 2020Quote: ... Stain was also added to the markers Hyperladder 1kb™ and Hyperladder 4™ (Bioline) to give final concentrations of 10x and 100x.
-
bioRxiv - Genetics 2020Quote: Separation of the amplified product was accomplished in a 4% (w/v) agarose (Bioline, London) gel in 1% (w/v ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR mix was composed of 5 μL of 5X MyTaq red PCR buffer (Bioline), 1.25 μL of 25 mM MgCl2 ...
-
bioRxiv - Zoology 2019Quote: ... 5’-TAAGCACTTGT CTGTGAAACTGCGA-3’ (Grajales and Rodriguez 2016) with 0.5 U 2x Mango Mix (Bioline), 2 μL of DNA template ...
-
bioRxiv - Systems Biology 2023Quote: ... Cells were collected 24 hours after transfection in 5 ml of TRIsure (#BIO-38032; Bioline) and frozen at -80 °C until further processing.
-
bioRxiv - Neuroscience 2020Quote: ... 20 μl of digest were run on 2 % agarose gel (BIOLINE, London, UK) and imaged on a trans illuminator ...