Labshake search
Citations for Bioline :
1 - 50 of 241 citations for 6 9 Methano 4 1 benzoxazepin 2 3H one octahydro 3 methyl 3 α 5a bta 6 bta 9 bta 9a bta 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... from Mediterranean and temperate species had germinated we transplanted up to 20 seedlings each into 9 × 9 cm pots (one plant per pot) with a 3:1 mixture of potting soil (Einheitserde®, BioLine, Topfsubstrat Öko torffrei) and sand (0-2 mm play sand ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1.0% (wt/vol) DNase (Bioline, 9003-98-9) in calcium- and magnesium-free 1X HBSS (Gibco ...
-
bioRxiv - Developmental Biology 2019Quote: ... 0.4 μM zebrafish genotyping primers (Extended Data Fig.5A, Table 2) and 1 x MyTaq Red DNA Polymerase (Bioline) according to the manufacturer’s protocol in a T100 thermal cycler ...
-
bioRxiv - Microbiology 2022Quote: ... 6 μl MyTaq Red DNA polymerase Mix (BioLine) and 1 μl of each primer (10 μmol) ...
-
bioRxiv - Genetics 2020Quote: ... CpGs 4-8 (F– TTTAGTAGAGGAAATAAAATAGTAGAAAAA-Biotinylated; R: CCCCAAAAAACCACAAAACCTA) CpGs 9-11 (F – GGATGGAGGAATTTTTTTGTGTT; R: CCCCAAAAAACCACAAAACCTA -Biotinylated) using MyTaq HS mix PCR reagents (Bioline). Amplicons were processed on the Qiagen Q24 Workstation and sequenced in duplicate on the Qiagen Q24 pyrosequencer using the sequencing primers CpGs 4-8 (AACAATTTAAACAAAAAATAACATT ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 mM MgCl (Bioline, Boston, MA), 1 mM dNTP (Bioline ...
-
bioRxiv - Molecular Biology 2023Quote: ... This cDNA library was then PCR barcoded with PCR Primer 1.0 (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG-3’) and a sample-specific barcode primer (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTG-3’) using MyTaq Red Mix (Bioline) for 15 cycles ...
-
bioRxiv - Genetics 2023Quote: ... An 800–base pair region surrounding the target site of the Cypor sgRNA was amplified (forward primer 5′-GTTTGCGGGTGTTAGCTCTTC-3′; reverse primer 5′-TTGGTGGGTAAATCACACCGT-3′) using MyTaq Red Mix (Bioline). The amplicon was purified using the PCR clean-up and gel extraction kit (Macherey-Nagel ...
-
bioRxiv - Pathology 2024Quote: ... then incubated overnight at 37°C with staining buffer (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside [X-gal, Bioline, London ...
-
bioRxiv - Immunology 2022Quote: ... DNA amplifications for the conTRT amplicons were performed similarly except Ranger DNA polymerase (1×10-6 approximate error/bp) from Bioline was utilized ...
-
bioRxiv - Microbiology 2021Quote: ... and 3 μL of Proteinase K (20 mg/ mL, Bioline Australia Pty Ltd ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... and 3 μL of Proteinase K (20 mg/ mL, Bioline Australia Pty Ltd ...
-
bioRxiv - Neuroscience 2022Quote: ... Dehydrated samples were rehydrated through a series of methanol/PBS washes for 10 minutes each at room temperature with an additional 3 x 10 minutes PBSTw (0.1% Tween-20) and treated with proteinase K (1:1000, Bioline) for 20 minutes to increase permeabilization ...
-
bioRxiv - Developmental Biology 2022Quote: ... The PCR was performed using MyTaq polymerase (Bioline; PCR program in Supplementary Table 3). If embryos showed the desired deletions ...
-
bioRxiv - Developmental Biology 2022Quote: ... The PCR was performed using MyTaq polymerase (Bioline; PCR program in Supplementary Table 3). If embryos showed deletions ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was isolated from cells 3 hours after inducing socRNA expression using TRIsure (Bioline). Subsequently ...
-
bioRxiv - Molecular Biology 2020Quote: ... A CCDC26 exon 6 DNA template was generated by performing a PCR using Red Mix (Bioline, Cat. No. BIO25043) WT K562 cDNA and CCDC26-specific primers that incorporated a T7 RNA polymerase promoter at the 5’-end of the DNA strand to be later transcribed (Supplementary Table 1) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.25uM forward and reverse oligo primers (see supplementary table 6) and SensiFAST SYBR Hi-ROX Kit (Bioline, BIO-92005) in 384-well plates with the LightCycler 480 Instrument II (Roche ...
-
bioRxiv - Zoology 2019Quote: ... 5’-TAAGCACTTGT CTGTGAAACTGCGA-3’ (Grajales and Rodriguez 2016) with 0.5 U 2x Mango Mix (Bioline), 2 μL of DNA template ...
-
bioRxiv - Immunology 2022Quote: ... 3 µL of 5x PyroTaq EvaGreen qPCR Mix Plus with ROX (Cultek Molecular Bioline, Madrid, Spain), and transcript-specific forward and reverse primers at a 10 μM final concentration ...
-
bioRxiv - Biophysics 2021Quote: ... coli α-Select (Bioline, UK) was used for general plasmid storage and propagation ...
-
bioRxiv - Microbiology 2021Quote: ... The resulting PCR products from slurry and syringe method control samples were purified as follows: 30 μl of PCR product per sample was mixed with 6 μl 5X loading dye (Bioline, London, UK) and separated using a 1.5% agarose gel stained with SYBR Safe DNA gel stain (Invitrogen ...
-
bioRxiv - Microbiology 2019Quote: ... coli Silver α select cells (Bioline) were used for cloning and were grown in LB medium at 37°C with 25 μg/ml kanamycin or 10 μg/ml tetracycline when appropriate.
-
bioRxiv - Synthetic Biology 2020Quote: ... Escherichia coli α-Select (Bioline, UK) was used as a host for plasmid propagation ...
-
bioRxiv - Microbiology 2020Quote: ... coli α-select silver efficiency (Bioline) was used to manipulate the pGEM-TEasy library of gene cassettes ...
-
bioRxiv - Cell Biology 2019Quote: ... cells from the transfection without repair plasmid were collected after 3 days for genome extraction (Bioline #BIO-52066) and PCR (NEB #M0491S ...
-
bioRxiv - Plant Biology 2020Quote: ... 3-day-old etiolated hypocotyls or roots were mounted in water under a pad of 0.8% agarose (Bioline). To limit the time that seedlings spent mounted ...
-
bioRxiv - Plant Biology 2021Quote: ... 3-day-old etiolated hypocotyls or roots were mounted in water under a pad of 0.8% agarose (Bioline). To limit the time that seedlings spent mounted ...
-
bioRxiv - Neuroscience 2022Quote: ... using 3 ng of cDNA per reaction and Sensifast SYBR No-ROX mix (Bioline Corporation, Alvinston, ON, Canada). Complementary DNA of mRNA was amplified using a pair of specific forward and reverse primers (Supplementary Table 2) ...
-
bioRxiv - Genomics 2020Quote: ... 2 □1 water and 5□1 MyTaq™ HS Mix (Bioline). RT-PCR was performed in the following conditions ...
-
bioRxiv - Molecular Biology 2022Quote: ... and insertions were validated as empty/filled and/or by 5’ and 3’ junction PCRs using MyTaq HS DNA polymerase (Bioline). Validation products were run on 1% agarose gels ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The DNA was used as template for PCR amplification of the targeted sites with primers listed on Supplementary Table 3 and using MyTaq™ DNA Polymerase (Bioline). Subsequently ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primers were designed using NCBI primer blast (Table 3) and qRT-PCR was performed using SensiFAST™ SYBR Lo-ROX Kit (#BIO-94020, Bioline) on the BIO-RAD CFX38 Real time PCR machine ...
-
bioRxiv - Microbiology 2021Quote: ... 1:10 dilutions of RNA samples were analyzed using SensiFast SYBR Hi-ROX One-Step kit (Bioline, UK) and 400 nM primer concentrations ...
-
bioRxiv - Microbiology 2020Quote: ... coli α-Select competent cells were obtained from Bioline Reagents Ltd (UK) ...
-
bioRxiv - Biochemistry 2022Quote: ... coli α-select chemically competent cells (Bioline BIO-85026) and colonies were selected on YT glucose plus 50 mg/mL spectinomycin HCl (Sigma-Aldrich S9007) ...
-
bioRxiv - Molecular Biology 2021Quote: ... after which α-Select Bronze Efficiency Competent Cells (Bioline) were transformed with the ligation products ...
-
bioRxiv - Microbiology 2020Quote: ... The MyTaq One-Step RT-PCR Kit (Bioline) was used to generate and amplify cDNA from viral RNA isolated from nasal wash samples (as above) ...
-
bioRxiv - Cell Biology 2019Quote: ... The amount of M and NA segment was determined with one-step RT-qPCR using SensiFAST™ Probe Lo-ROX One-Step Kit (Bioline). The sequences of primers and probe for M segment detection are AGA TGA GYC TTC TAA CCG AGG TCG (forward primer) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL 1:1 diluted cDNA and SensiFAST SYBR No-ROX Kit (#BIO-98005, Bioline). Knockdown was assessed using ΔΔCt analysis as described by Pfaffl [92].
-
bioRxiv - Genomics 2021Quote: ... One-step reverse-transcription quantitative PCR (RT-qPCR) was performed with the SensiFAST™ SYBR® No-ROX One-Step kit (Bioline®) on an Eco™ Real-Time PCR System (Ilumina® ...
-
bioRxiv - Molecular Biology 2020Quote: ... coli as per manufacturer’s protocol (α-Select Competent Cells, Bioline, Australia). The transformed cells were grown overnight (37° ...
-
bioRxiv - Plant Biology 2019Quote: ... and transformed into Escherichia coli α-select chemically competent cells (Bioline) via heat shock ...
-
bioRxiv - Biochemistry 2021Quote: ... The amplified DNA was transformed into α-select competent cells (Bioline) by heat shock and plated on Luria-Bertani broth (LB ...
-
bioRxiv - Microbiology 2021Quote: ... 125nM) and SensiFAST Probe Hi-ROX One-Step Kit (Bioline) according to the manufacturer’s instructions in a 20μl reaction with 5μl sample ...
-
bioRxiv - Microbiology 2020Quote: ... The Sensi-FAST SYBR Hi-ROX One-Step Kit (Bioline) was used for quantitative real time PCR (qRT-PCR) ...
-
bioRxiv - Genetics 2022Quote: The full exon 3 of PRNP gene (771 bp) of all animals was amplified by PCR using MyTaq™ Red Mix (Bioline Meridian Life Sciences-BIO-25043). Briefly ...
-
bioRxiv - Cell Biology 2020Quote: ... subsequently diluted in water (1:4) and mixed with SensiFAST SYBR Hi-Rox (Bioline) and the appropriate primers at a final concentration of 10 μM ...
-
bioRxiv - Microbiology 2019Quote: ... A SensiFAST Probe No-ROX One-Step Kit (Bioline, NSW, Australia) was used to carry out the gene expression study following the manufacture’s protocol with a Rotor-gene Q Instrument (Qiagen ...
-
bioRxiv - Synthetic Biology 2022Quote: ... each well contained 1 mL LB agar supplemented with 2 mM IPTG (Bioline), 5 μg/mL chloramphenicol (MilliporeSigma) ...