Labshake search
Citations for Bioline :
1 - 50 of 125 citations for 6 9 DIMETHOXY PHENAZINE 1 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... from Mediterranean and temperate species had germinated we transplanted up to 20 seedlings each into 9 × 9 cm pots (one plant per pot) with a 3:1 mixture of potting soil (Einheitserde®, BioLine, Topfsubstrat Öko torffrei) and sand (0-2 mm play sand ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1.0% (wt/vol) DNase (Bioline, 9003-98-9) in calcium- and magnesium-free 1X HBSS (Gibco ...
-
bioRxiv - Immunology 2022Quote: ... DNA amplifications for the conTRT amplicons were performed similarly except Ranger DNA polymerase (1×10-6 approximate error/bp) from Bioline was utilized ...
-
bioRxiv - Microbiology 2022Quote: ... 6 μl MyTaq Red DNA polymerase Mix (BioLine) and 1 μl of each primer (10 μmol) ...
-
bioRxiv - Microbiology 2021Quote: ... 458/459/JL-D2) in TBE (Tris, boric acid, ethylenediaminetetraacetic acid) and product size approximated using HyperLadderII 50bp DNA marker (Bioline, Sydney, Australia).
-
bioRxiv - Genetics 2020Quote: ... CpGs 4-8 (F– TTTAGTAGAGGAAATAAAATAGTAGAAAAA-Biotinylated; R: CCCCAAAAAACCACAAAACCTA) CpGs 9-11 (F – GGATGGAGGAATTTTTTTGTGTT; R: CCCCAAAAAACCACAAAACCTA -Biotinylated) using MyTaq HS mix PCR reagents (Bioline). Amplicons were processed on the Qiagen Q24 Workstation and sequenced in duplicate on the Qiagen Q24 pyrosequencer using the sequencing primers CpGs 4-8 (AACAATTTAAACAAAAAATAACATT ...
-
bioRxiv - Molecular Biology 2020Quote: ... Nucleic acids were precipitated with three volumes of ethanol in the presence of a co-precipitating agent (PINK, Bioline) and dissolved in 20 μl of milliQ-grade water.
-
bioRxiv - Molecular Biology 2020Quote: ... A CCDC26 exon 6 DNA template was generated by performing a PCR using Red Mix (Bioline, Cat. No. BIO25043) WT K562 cDNA and CCDC26-specific primers that incorporated a T7 RNA polymerase promoter at the 5’-end of the DNA strand to be later transcribed (Supplementary Table 1) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.25uM forward and reverse oligo primers (see supplementary table 6) and SensiFAST SYBR Hi-ROX Kit (Bioline, BIO-92005) in 384-well plates with the LightCycler 480 Instrument II (Roche ...
-
bioRxiv - Immunology 2022Quote: ... Purified nucleic acid was then immediately converted to cDNA by reverse transcription with random hexamers using the SensiFAST cDNA Synthesis Kit (Bioline Reagents, UK) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The resulting PCR products from slurry and syringe method control samples were purified as follows: 30 μl of PCR product per sample was mixed with 6 μl 5X loading dye (Bioline, London, UK) and separated using a 1.5% agarose gel stained with SYBR Safe DNA gel stain (Invitrogen ...
-
bioRxiv - Genomics 2020Quote: ... 2 □1 water and 5□1 MyTaq™ HS Mix (Bioline). RT-PCR was performed in the following conditions ...
-
bioRxiv - Immunology 2020Quote: ... 1 ml of Trisure (Bioline) was added and mixed ...
-
bioRxiv - Microbiology 2023Quote: ... and HyperlLadder 1 kb (Bioline) was used for size determination.
-
bioRxiv - Evolutionary Biology 2023Quote: ... and 1 kb Hyperladder (Bioline). PCR products were purified using Mag-Bind RXNPurePlus beads (OMEGA Biotek ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL 1:1 diluted cDNA and SensiFAST SYBR No-ROX Kit (#BIO-98005, Bioline). Knockdown was assessed using ΔΔCt analysis as described by Pfaffl [92].
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1 mM dNTP (Bioline, Boston, MA), 250 nmol forward and reverse primers (IDT ...
-
bioRxiv - Genomics 2021Quote: ... 1 × MyTaq™ Red Mix (Bioline), 10 pmoles each primer and 0.25 μL (1.25 U ...
-
bioRxiv - Microbiology 2022Quote: ... with a 1 kb HyperLadder (Bioline) marker ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and a 1 kbp HyperLadder (Bioline). Genomic DNA extraction from new tissue samples was conducted using the MagJet gDNA kit (Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1 unit Biolase Taq (Bioline, Boston, MA), and 1 μl of template DNA ...
-
bioRxiv - Microbiology 2019Quote: ... 1 µl of 10 mM dNTP’s (BioLine), and 0.25 µl iProof (BioRad) ...
-
bioRxiv - Cell Biology 2021Quote: ... run with Hyperladder 1 DNA marker (Bioline). Selected clones were confirmed to have centrosomal localisation as expected by Airyscan confocal imaging ...
-
bioRxiv - Molecular Biology 2020Quote: ... qPCRs were run using 2 µl cDNA (diluted 1:1) in a 10 µl reaction with 5 µl SensiFAST SBYR No-ROX Kit (Bioline) and 0.1 µM of each primer ...
-
bioRxiv - Developmental Biology 2019Quote: ... PCR reactions were resolved in 1 % agarose (Bioline) gels containing 0.5 μg/ml Ethidium Bromide (Sigma ...
-
bioRxiv - Cancer Biology 2020Quote: ... DNA weight marker Hyperladder™ 1-kb (BIoline) and UltraRanger 1kb (Norgen Biotek ...
-
bioRxiv - Genomics 2023Quote: ... 1’ 72°C) by MyTaq Red mix (Bioline) using primers that add overhangs with EcoRI (MT024 ...
-
bioRxiv - Genetics 2023Quote: ... Hyperladder 50 bp or Hyperladder 1 kb (Bioline) served as DNA fragment size markers.
-
bioRxiv - Immunology 2023Quote: ... The total qPCR reaction volume was 1.5 μl and consisted of 0.5 μl of cDNA (dilution 1/12) and 1 μl of SensiFAST™ SYBR® No-ROX Kit (Bioline) containing 0.4 μM of PCR primer (Eurogenetec SA)(primer list in sup ...
-
bioRxiv - Microbiology 2019Quote: ... A second round of amplification was performed by transferring 5μl of 1:100 diluted Round 1 product into 15μl Bioline MyFi™ Mix (BIOLINE GmbH, Luckenwalde, Germany) reactions.
-
bioRxiv - Immunology 2023Quote: ... the aqueous phase was mixed 1:1 v/v with 70% ethanol and loaded into a column of the Isolate II RNA Mini kit (Bioline, Cincinnati, OH). Total RNA was purified following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... 1 ng human genomic DNA (Bioline, Cat. # BIO-35025) was used as negative control ...
-
bioRxiv - Molecular Biology 2021Quote: ... The final volume contained 1× SensiMix (Bioline, London, UK), 800 nM of each primer and 200nM of each probe and the PCR cycling conditions included an initial denaturation at 95°C for 10 minutes ...
-
bioRxiv - Genomics 2023Quote: ... Samples were compared to 1 Kb hype ladder (Bioline). The primer sequences are listed in Table S9.
-
bioRxiv - Cell Biology 2023Quote: ... and 1 unit of Taq polymerase (Bioline, Meridian Bioscience). The PCR conditions were an initial melting step of 94°C for 4 min ...
-
bioRxiv - Microbiology 2019Quote: ... The 1 kb molecular weight marker (HyperLadder IV, Bioline, UK) was used in together with the amplified products ...
-
bioRxiv - Microbiology 2020Quote: ... for 1 minute in 0.2 mL TRIsure (Bioline: BIO-38033). Homogenized tissue was brought to 1 mL volume with 0.8 mL TRIsure ...
-
bioRxiv - Genetics 2020Quote: ... and 1 Unit MyTaqTM (Bioline; Meridian Bioscience Inc., London, UK) by incubation for 2 min at 96°C ...
-
bioRxiv - Genomics 2023Quote: ... supplemented with 1:100 10 mg/mL Proteinase K (Bioline). TIDE was performed as described before (40) ...
-
bioRxiv - Microbiology 2021Quote: ... using 5 μl product with 1 μl 5X loading dye (BioLine) to verify bands of approximately 450 bp ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Molecular weight markers used were the 1 kb HyperLadder (from Bioline). T4 DNA ligase and buffer were purchased from New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... The resultant bands were compared to a 1 Kb HyperLadder (Bioline) using the expected sizes per gene region as follows ...
-
bioRxiv - Molecular Biology 2020Quote: ... buffer with 1 mg/ml Proteinase K (Bioline, Cat. No. BIO-37084) to pre-lyse the cells ...
-
bioRxiv - Microbiology 2019Quote: ... A 1 kilobase molecular-weight size marker (Hyperladder 1KB from Bioline UK) was used to confirm that the 16S ribosomal RNA hypervariable region had been isolated (supplementary material) ...
-
bioRxiv - Microbiology 2021Quote: ... 1% SDS (Sigma-Aldrich)] supplemented with 5 μL Proteinase K (20 mg mL−1; Bioline Australia) to lyse cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... supplemented with 1 mg/ml proteinase K (Bioline, cat. no. BIO-37084) by incubating them at 55 °C for at least 2 hours up to overnight ...
-
bioRxiv - Molecular Biology 2020Quote: ... or HyperLadder 1 kb (range 200 bp to 10 kb, BIO-33053, Bioline) to determine product sizes.
-
bioRxiv - Plant Biology 2020Quote: ... The PCR product was visualized on a 1% (w/v) agarose gel (Bioline) by electrophoresis at 90 V for 1 h and the 1.5 kb target band was collected for purification using NucleoSpin® Gel and PCR Clean-up kit (Macherey-Nagel ...
-
bioRxiv - Synthetic Biology 2022Quote: ... each well contained 1 mL LB agar supplemented with 2 mM IPTG (Bioline), 5 μg/mL chloramphenicol (MilliporeSigma) ...
-
bioRxiv - Biochemistry 2022Quote: ... RNA samples (1 µg) were reverse transcribed using SensiFAST cDNA synthesis kit (Bioline) according to manufacturer’s protocol and subjected to Real-time quantitative PCR (RT-qPCR ...