Labshake search
Citations for Bioline :
1 - 50 of 750 citations for 11 Ketotestosterone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... and 5-µL of SensiFAST SYBR & Fluorescein Kit (Bioline). Each sample was measured in triplicate ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 5 μl of 2X SensiFAST SYBR No-ROX kit (Bioline) in a 10 μl total volume ...
-
bioRxiv - Plant Biology 2023Quote: ... qPCR was performed in 96-well plates using the SensiFastTM SYBR No-ROX Kit (Bioline) in technical triplicates for each biological replicate ...
-
bioRxiv - Plant Biology 2023Quote: Measurements were carried out in 96-well plates using the SensiFAST™ SYBR® Kit (Bioline, Luckenwalde, Germany) in a LightCycler® 480 (Roche) ...
-
bioRxiv - Physiology 2022Quote: ... qPCRs were carried out in 15 μl in a 384-well plate using SensiFASTTM SYBR Hi-ROX kit (Bioline), 0·5 μM of each forward and reverse primer and 2·5 μl of template DNA ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 µl of (2x) SYBR green master mix (SensiFAST SYBR kit, Bioline, London, United Kingdom; BIO- 94005) was used and combined with 0.4 µl of a combined forward and reverse primer mix (10 uM of forward and reverse primers in the combined master mix ...
-
bioRxiv - Genetics 2020Quote: ... CpGs 4-8 (F– TTTAGTAGAGGAAATAAAATAGTAGAAAAA-Biotinylated; R: CCCCAAAAAACCACAAAACCTA) CpGs 9-11 (F – GGATGGAGGAATTTTTTTGTGTT; R: CCCCAAAAAACCACAAAACCTA -Biotinylated) using MyTaq HS mix PCR reagents (Bioline). Amplicons were processed on the Qiagen Q24 Workstation and sequenced in duplicate on the Qiagen Q24 pyrosequencer using the sequencing primers CpGs 4-8 (AACAATTTAAACAAAAAATAACATT ...
-
bioRxiv - Cell Biology 2020Quote: ... Then 5 μg of the extracted RNA was reversely transcribed by utilizing Tetro cDNA Synthesis Kit (Bioline, BIO-65043) and random Hexamer Primer according to the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2019Quote: ... with total reaction volume of 10 μl containing 5 μl Rotor-Gene SYBR® Green PCR Kit (Bioline, Australia), 0.3 μl each of 10 μM forward and reverse primer and 2 μl of genomic DNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4.2 µL purified DNA from chromatin immunoprecipitation was mixed with 5 µL 2x SensiFAST SYBR No-ROX kit (Bioline) and 0.4 µL forward and reverse primer (10 µM) ...
-
bioRxiv - Microbiology 2021Quote: RNA from GP barley infected with Fg-IFA65 at 5 dpi and an uninfected control was extracted with the Isolate II plant miRNA kit (Bioline). 1 µg of RNA (>200 nt ...
-
bioRxiv - Molecular Biology 2020Quote: ... qPCRs were run using 2 µl cDNA (diluted 1:1) in a 10 µl reaction with 5 µl SensiFAST SBYR No-ROX Kit (Bioline) and 0.1 µM of each primer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Isolated RNA (0.5-1 µg) was then used for reverse transcription into first strand cDNA via a SensiFast cDNA synthesis kit (Bioline). RNA spike I (TATAA ...
-
bioRxiv - Microbiology 2023Quote: ... The reactions (10 μL total volume) contained 5 μL of 2 × SensiFAST™ SYBR No-ROX Kit (Bioline, London, UK), 0.2 μM of each arsM gene primer ...
-
bioRxiv - Cancer Biology 2019Quote: ... cDNA was amplified on quantitative PCR in a total volume of 5 μl with SensiFAST SYBR® No-ROX Kit (Bioline) and specific primers on a LightCycler 480 (Roche) ...
-
bioRxiv - Physiology 2021Quote: ... the K13 locus was amplified directly from whole blood using the primer pair p26+p27 (Supplementary file 5) and the MyTaq™ Blood-PCR Kit (Bioline). Primer pairs p39+p40 and p50+p51 were used to amplify fd and mdr2 ...
-
bioRxiv - Microbiology 2022Quote: ... with a 5μL 5 HyperLadderTM 100bp (Bioline) to confirm product size ...
-
bioRxiv - Molecular Biology 2023Quote: ... This cDNA library was then PCR barcoded with PCR Primer 1.0 (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG-3’) and a sample-specific barcode primer (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTG-3’) using MyTaq Red Mix (Bioline) for 15 cycles ...
-
bioRxiv - Genetics 2023Quote: ... An 800–base pair region surrounding the target site of the Cypor sgRNA was amplified (forward primer 5′-GTTTGCGGGTGTTAGCTCTTC-3′; reverse primer 5′-TTGGTGGGTAAATCACACCGT-3′) using MyTaq Red Mix (Bioline). The amplicon was purified using the PCR clean-up and gel extraction kit (Macherey-Nagel ...
-
Increased ACTL6A Occupancy Within mSWI/SNF Chromatin Remodelers Drives Human Squamous Cell CarcinomabioRxiv - Molecular Biology 2021Quote: ... cells were lysed directly on culture plates with TRIsure reagents (Bioline), and RNA was extracted using Direct-zol RNA MiniPrep kits (Zymo Research ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were set up in total volumes of 10 µl each, containing 5× MyTaq reaction buffer (5 mM dNTPs, 15 mM MgCl2, stabilizers and enhancers) (Bioline, London, UK), 2 µM of each primer ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... consisting of 5 μL MyTaq HS DNA Polymerase (Bioline), 0.2 μL of each forward and reverse primer ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 μl of 2x SYBR green master mix (Bioline), 1μl (5 pmol/μl ...
-
bioRxiv - Immunology 2022Quote: ... using either BIOLASETM polymerase (7×10-5 approximate error/bp) or MyFiTM polymerase (7×10-5 approximate error/bp) both from Bioline (Meridian Bioscience, USA). The PCR mixture consisted of 1X buffer with 1mM dNTP ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and 2.5-5 μL of Proteinase K (20 mg/mL, Bioline Australia Pty Ltd ...
-
bioRxiv - Microbiology 2021Quote: ... using 5 μl product with 1 μl 5X loading dye (BioLine) to verify bands of approximately 450 bp ...
-
bioRxiv - Genetics 2021Quote: ... 0.125 μL IMMOLASE™ DNA Polymerase (5 u/μL) (Bioline (Aust) Pty Ltd ...
-
bioRxiv - Genomics 2020Quote: ... 2 □1 water and 5□1 MyTaq™ HS Mix (Bioline). RT-PCR was performed in the following conditions ...
-
bioRxiv - Genomics 2022Quote: ... Each reaction contained 5 μl SensiFAST 1x LoRox SYBR Mix (Bioline), 0.25 μl forward primer (10 μM) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and vehicle was added to control plates 24 hours before RNA isolation using Trisure (Bioline) per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... and IMMOLASETM DNA polymerase (5 U/μl) (Bioline; Cat. No. BIO-21047) as described by Lee et al ...
-
bioRxiv - Immunology 2020Quote: ... 5 - 10 ng DNA was used for amplification with MyTaq Polymerase (Bioline). The PCR cycling conditions were as follows ...
-
bioRxiv - Microbiology 2022Quote: ... and IMMOLASETM DNA polymerase (5 U/μl) (Bioline; Cat. No. BIO-21047) as described by Lee et al ...
-
bioRxiv - Microbiology 2021Quote: ... 1% SDS (Sigma-Aldrich)] supplemented with 5 μL Proteinase K (20 mg mL−1; Bioline Australia) to lyse cells ...
-
bioRxiv - Microbiology 2019Quote: ... using the amplification kit SensiFAST SYBR No-Rox kit (Bioline, London, UK), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Each 100 μl PCR reaction contained 5 U MyTaq DNA polymerase (Bioline, Australia), 1 × MyTaq reaction buffer ...
-
bioRxiv - Microbiology 2021Quote: ... and IMMOLASE™ DNA polymerase (5 U/μl) (Bioline; Cat. No. BIO-21047) as described by Lee et al ...
-
bioRxiv - Bioengineering 2022Quote: ... SensiFAST cDNA Synthesis Kit and the SensiFAST SYBR Lo-ROX Kit (Bioline, NSW, Australia), respectively ...
-
bioRxiv - Immunology 2021Quote: ... Sensifast cDNA synthesis kit (Bioline) was used to transcribe total RNA to cDNA ...
-
bioRxiv - Developmental Biology 2022Quote: ... No-ROX Kit (Bioline, USA), 150nM forward primer ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 2 μL of diluted cDNA were combined with 5 μL SYBR Green (Bioline, Luckenwalde, Germany), 0.2 μL of each forward and reverse primer and 4.6 μL DEPC-water ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR mix was composed of 5 μL of 5X MyTaq red PCR buffer (Bioline), 1.25 μL of 25 mM MgCl2 ...
-
bioRxiv - Zoology 2019Quote: ... 5’-TAAGCACTTGT CTGTGAAACTGCGA-3’ (Grajales and Rodriguez 2016) with 0.5 U 2x Mango Mix (Bioline), 2 μL of DNA template ...
-
bioRxiv - Systems Biology 2023Quote: ... Cells were collected 24 hours after transfection in 5 ml of TRIsure (#BIO-38032; Bioline) and frozen at -80 °C until further processing.
-
bioRxiv - Evolutionary Biology 2020Quote: ... Sensifast Hi-Rox SyBr kit (Bioline) was used to perform the RT-qPCR on a StepOnePlus system (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... and a SensiFast Probe kit (Bioline). Expression of tubulin was used to normalize the expression of target genes ...
-
bioRxiv - Plant Biology 2022Quote: ... and the qPCR SensiMix kit (BioLine, GC Biotech BV ...
-
bioRxiv - Physiology 2019Quote: ... SYBR® No-ROX Kit (Bioline) in an Applied Biosysems cycler (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... using SensiFAST cDNA Synthesis Kit (Bioline). The quality and concentration of template RNA and of cDNA were assessed with NanoDrop OneC Microvolume UV-Vis Spectrophotometer (ThermoFisher Scientific) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and SensiFAST cDNA Synthesis Kit (Bioline), respectively ...