Labshake search
Citations for Bioline :
351 - 400 of 951 citations for hsa mir 296 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... A 25 µl PCR reaction contained 1x MyTaq ™ Red Mix (Bioline, South Africa), eight species-specific forward and reverse primers at a final concentration of 6.25 µM (Table 1) ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCR (qPCR) reactions (20 μl) included 1X SensiMix SYBR green master mix (Bioline), 0.5 μM of each primer and 5 μl template cDNA (used at 1:200 dilution in RNase-free water) ...
-
bioRxiv - Microbiology 2022Quote: ... PCR used a total volume of 20 µL with 10 µL BioMix (BioLine, UK) 1 µL of each primer (10 µM) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... PCR used a total volume of 20 μL with 10 μL BioMix (BioLine, UK) 1 μL forward primer (10 μM) ...
-
bioRxiv - Plant Biology 2020Quote: ... The final PCR products were visualized on a 1% (w/v) agarose gel (Bioline) by electrophoresis at 90 V for 1 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR was performed using 10 μl MyTaq Red mix (Bioline, cat. no. BIO-25044), 1 μM of each TAC0017 and TAC0018 primers ...
-
bioRxiv - Microbiology 2019Quote: ... using the amplification kit SensiFAST SYBR No-Rox kit (Bioline, London, UK), according to the manufacturer’s instructions ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... and real-time qPCR using primer sets (CYP1A1: CAACCCTTCCCTGAATGCCT and GCTTCTCCTGACAGTGCTCA; CYP1B1: AACGTACCGGCCACTATCAC and TCACCCATACAAGGCAGACG) and 2x SensiMix SYBR & Fluorescein Mastermix (Bioline QT615-05) on the iCycler (Bio-Rad).
-
bioRxiv - Genetics 2021Quote: ... A total of 14 PCR cycles were performed using MyTaq Red Mix (#BIO-25043; Bioline), yielding ~30 μg barcodes ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR reaction volumes are as follows: 12.5 μL MyTaqTM Master Mix (Bioline, United Kingdom), 10 μL molecular-grade water (G-Biosciences ...
-
bioRxiv - Plant Biology 2022Quote: ... qRT-PCR assays were performed using PyroTaq EvaGreen mix Plus (ROX) (CulteK Molecular Bioline, Spain) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... A DNA contamination PCR was performed using MyTaq™ DNA Polymerase (Bioline cat # BIO-21105) and primers for ACTB to check for the presence of genomic DNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR reactions were carried out with ∼100 ng genomic DNA in MyTaq Red mix (Bioline) and purified using the PCR Isolate II PCR and Gel Kit (Bioline ...
-
bioRxiv - Genomics 2020Quote: ... PCRs were carried out as 25 µl reactions containing 0.03 units of MyTaq™ (Bioline), 1 × buffer and 0.2 μM of forward and reverse primers and 2 μl of template DNA ...
-
bioRxiv - Microbiology 2021Quote: ... The final PCR product (sequencing library) was purified with JetSeq Beads (Bioline, Cat # BIO-68031), followed by library quality control check ...
-
bioRxiv - Biochemistry 2022Quote: Two versions of arsB were PCR amplified using VELOCITY DNA Polymerase (Bioline; catalog #BIO-21098) following manufactures recommendations ...
-
bioRxiv - Genetics 2024Quote: ... All genotyping PCRs were carried out using MyTaq™ Red Mix (Bioline, Cat# BIO-25043) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... All three PCR reactions contain 10 µL of MyTaq HS Red mix (BIO-25048, Bioline), 2-3 µL of the crude extract and 1 µL of each primer (10 µM ...
-
bioRxiv - Bioengineering 2022Quote: ... SensiFAST cDNA Synthesis Kit and the SensiFAST SYBR Lo-ROX Kit (Bioline, NSW, Australia), respectively ...
-
bioRxiv - Immunology 2021Quote: ... Sensifast cDNA synthesis kit (Bioline) was used to transcribe total RNA to cDNA ...
-
bioRxiv - Developmental Biology 2022Quote: ... No-ROX Kit (Bioline, USA), 150nM forward primer ...
-
bioRxiv - Microbiology 2019Quote: ... each PCR assay was set-up with nuclease-free water as the negative control (Bioline, UK), and positive controls were not included due to financial constraints ...
-
bioRxiv - Neuroscience 2020Quote: ... Quantitative PCR was performed using C1000 Touch Thermal Cycler (BioRed) and SYBR mix (Bioline, GmbH, Germany), using validated primer sets (Herber et al ...
-
bioRxiv - Plant Biology 2020Quote: ... Quantitative PCR was carried out using 5x PyroTaq qPCR mix Plus EvaGreen (CMB Cultek Molecular Bioline) in a QuantStudio5 machine (Applied Biosystems) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The tagmented DNA was added to a PCR reaction with 2x MyTaq mix (BIO-25041; Bioline) with primers that add library specific indexes and amplified for 10 cycles ...
-
bioRxiv - Microbiology 2021Quote: ... Four oligonucleotides were designed [40] for PCR using MyTaq Red Mix 1X (Bioline, Cat#BIO-25043), according to the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2022Quote: ... TE-genome junction validation PCRs were performed using MyTaq HS DNA Polymerase (Bioline, Cat#: BIO-2111). Reaction mixes contained 5μL 5× MyTaq Reaction Buffer ...
-
bioRxiv - Microbiology 2021Quote: ... Marker-exchange plasmids were generated by ligation of the PCR products in α-select cells (Bioline) using the SLIC cloning method (41) ...
-
bioRxiv - Molecular Biology 2020Quote: ... target regions were amplified by PCR using 50 ng genomic DNA in MyTaq Red mix (Bioline) according to manufacture instructions (primers are shown in Table S3) ...
-
bioRxiv - Plant Biology 2023Quote: The subsequent amplification step of the PCR was performed using MangoTaq™DNA Polymerase (Bioline, Belgium) and the primers LCO1490 and HCO2198 designed by Folmer et al. ...
-
bioRxiv - Plant Biology 2024Quote: ... Quantitative PCR was carried out using 5x PyroTaq qPCR mix Plus EvaGreen (CMB Cultek Molecular Bioline) in a QuantStudio5 machine (Applied Biosystems) ...
-
bioRxiv - Genomics 2019Quote: ... 8 µl of DpnII-digested products was amplified by PCR with MyTaq Red Mix (Bioline #BIO-25044) and 1.25 µM primers Adr-PCR-Rand1 in a total volume of 40 µl ...
-
bioRxiv - Plant Biology 2020Quote: ... Table 1) were used in a pre-optimised PCR master mix (BioMix™, Bioline, Meridian Bioscience; Australia) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... For conventional PCR we used a commercial master mix 2x My Taq HS Mix (Bioline Bio-25046). PCR amplifications were carried out in the T-100 Thermal Cycler (Biorad) ...
-
bioRxiv - Cancer Biology 2022Quote: PCR reactions were performed in 25 μl reactions using the MyTaq Red Mix (Bioline, Meridian Life Science). The RT-PCR reaction conditions were optimised for each primer pair and are designated as Condition A to D ...
-
bioRxiv - Microbiology 2022Quote: ... mutants were selected by PCR screening of colonies grown on LBN + 5% sucrose using Taq polymerase (Bioline) and the primers RSTX_For (5’-GTCACGGGTTGATTGATTCGCAT-3’ ...
-
bioRxiv - Molecular Biology 2021Quote: ... cell lysates were diluted and 5 μl was used for genotyping PCR using MyTaq DNA polymerase (Bioline) with indicated DNA primers ...
-
bioRxiv - Genetics 2022Quote: Genotyping was performed using standard PCR protocols for MyTaq HotStart Red Mix (Bioline BIO- 25048, Memphis, TN) with primers listed in Supplementary Table 7.
-
bioRxiv - Molecular Biology 2020Quote: ... Both PCR reactions were carried out with 25 µl MyTaq Red mix (Bioline cat. no. BIO-25044), 0.5 µM of each primer and 50 µl final volume ...
-
bioRxiv - Molecular Biology 2021Quote: ... 8 μl of DpnII-digested products was amplified by PCR with MyTaq Red Mix (Bioline #BIO-25044) and 1.25 μM primers Adr-PCR-Rand1 in a total volume of 40 μl ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plasmids were generated by PCR amplification of sequences of interest with Velocity DNA Polymerase (Bioline, #BIO-21099) using primers synthesized by IDT or restriction enzyme digestion with NEB High-Fidelity enzymes ...
-
bioRxiv - Neuroscience 2022Quote: ... Multiplex PCR amplification was performed in a 10 μL reaction containing 1X MyTaq HS Red Mix (Bioline), 10 ng DNA template ...
-
bioRxiv - Microbiology 2023Quote: ... both samples were subjected to PCR with human GAPDH-specific primers41 and MyTaq polymerase (Bioline, Taunton, MA). Resulting PCR amplicons were visualized by agarose gel electrophoresis ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Sensifast Hi-Rox SyBr kit (Bioline) was used to perform the RT-qPCR on a StepOnePlus system (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... and a SensiFast Probe kit (Bioline). Expression of tubulin was used to normalize the expression of target genes ...
-
bioRxiv - Plant Biology 2022Quote: ... and the qPCR SensiMix kit (BioLine, GC Biotech BV ...
-
bioRxiv - Physiology 2019Quote: ... SYBR® No-ROX Kit (Bioline) in an Applied Biosysems cycler (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... using SensiFAST cDNA Synthesis Kit (Bioline). The quality and concentration of template RNA and of cDNA were assessed with NanoDrop OneC Microvolume UV-Vis Spectrophotometer (ThermoFisher Scientific) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and SensiFAST cDNA Synthesis Kit (Bioline), respectively ...
-
bioRxiv - Microbiology 2023Quote: ... using SensiFAST SYBR® kit (Bioline) and primers specific for the membrane protein gene of HCoV-OC43 and HCoV-229E (Vijgen et al. ...