Labshake search
Citations for Bioline :
201 - 216 of 216 citations for 7 chloro 3' 4 6 trimethoxy 5' methylspiro 1 benzofuran 2 6' cyclohex 2 ene 1' 3 dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... The Endpoint PCR amplification (gDNA concentration of 20-50 ng μl−1 per sample) for each target region were performed using MyFi™ DNA Polymerase Kit (Bioline GmbH, Luckenwalde, Germany) and specific primers (IDENTXX GmbH)in a PCR thermal cycler (T100 PCR thermal cycler ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell were propogated in either LB or TB media and protein expression was performed by inducing with 0.5 mM IPTG (Isopropyl ß-D-1-thiogalactopyranoside, Bioline, Cat No. BIO-37036) overnight at 180C ...
-
bioRxiv - Cancer Biology 2020Quote: The assay consists of 10 μl of reaction volume including 5 ul of 2X buffer (Bioline, Bio-11060), 2 ul of Primer/probe mix in 1xTE with final concentration of 100 nM-600 nM of primers and 50 nM – 500 nM of probes ...
-
bioRxiv - Microbiology 2020Quote: ... 2uL of the DNA extracted from sputum samples was used as a template in 20-mL qPCR reactions containing 1× SensiFAST™ Probe Hi-ROX (Bioline, Cat. No. BIO-82020), 200 nM probe ...
-
bioRxiv - Physiology 2021Quote: ... was performed with three primers (Figure 1 A, “a”: AAGGCGCATAACGATACCAC, “b”: TACAATGCAGGCTCCAAACAC, “c”: CGAGCACAGGAAGTTCAACA, Eurofins Genomics, Ebersberg/Germany) and the ImmoMix™ kit (Bioline, Cat. No BIO-25020) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... Tissue pieces were digested at 4 °C on an orbital shaker-incubator at 200 × rpm (Bioline Global, New South Wales, Australia). After overnight digestion ...
-
bioRxiv - Cell Biology 2020Quote: ... Then 5 μg of the extracted RNA was reversely transcribed by utilizing Tetro cDNA Synthesis Kit (Bioline, BIO-65043) and random Hexamer Primer according to the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2019Quote: ... with total reaction volume of 10 μl containing 5 μl Rotor-Gene SYBR® Green PCR Kit (Bioline, Australia), 0.3 μl each of 10 μM forward and reverse primer and 2 μl of genomic DNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... Each sample was measured in triplicate of 5 μl with the following final concentrations: Velocity Polymerase 0.6 U (Bioline), 1.2 x Hifi Buffer (Bioline) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4.2 µL purified DNA from chromatin immunoprecipitation was mixed with 5 µL 2x SensiFAST SYBR No-ROX kit (Bioline) and 0.4 µL forward and reverse primer (10 µM) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the Methyl Indexed PCR was performed by mixing 4 µL of ligated DNA with x-Gen Dual combinatorial Indexes (IDT) (125 nM final concentration) and MyTaq RedMix (Bioline, BIO-25048) in a final volume of 40 µL ...
-
bioRxiv - Microbiology 2021Quote: RNA from GP barley infected with Fg-IFA65 at 5 dpi and an uninfected control was extracted with the Isolate II plant miRNA kit (Bioline). 1 µg of RNA (>200 nt ...
-
bioRxiv - Cancer Biology 2019Quote: ... cDNA was amplified on quantitative PCR in a total volume of 5 μl with SensiFAST SYBR® No-ROX Kit (Bioline) and specific primers on a LightCycler 480 (Roche) ...
-
bioRxiv - Zoology 2022Quote: We set up 50 μl PCR reactions using 2.5 μl template DNA and 47.5 μl PCR mastermix made from 5 μl of 10× OptiBuffer (Bioline Reagents Ltd, UK), 2.5 μl of primer at 10 μM ...
-
bioRxiv - Physiology 2021Quote: ... the K13 locus was amplified directly from whole blood using the primer pair p26+p27 (Supplementary file 5) and the MyTaq™ Blood-PCR Kit (Bioline). Primer pairs p39+p40 and p50+p51 were used to amplify fd and mdr2 ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were prepared for qPCR in technical triplicates in 5 µL reaction volumes using SensiFAST SYBR Lo-ROX 2X master mix (Bioline; Cat. No. BIO-94005), custom qPCR primers from Integrated DNA Technologies used at a final concentration of 0.2 µM ...