Labshake search
Citations for Bioline :
151 - 200 of 732 citations for Human Golgi phosphoprotein 3 GOLPH3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... RNA was reverse transcribed by Tetro cDNA synthesis kit (Bioline) with the primer of ‘GAGCAAAGACCCCAACGAGA’ targeting MBaMV-GFP genome ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative PCR was performed using SensiFAST™ SYBR kit (BIOLINE). The primer sequences used for qPCR are listed in Table S1 ...
-
bioRxiv - Immunology 2023Quote: ... RNA was isolated using ISOLATE II RNA Mini Kit (Bioline) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline). Gene expression was measured using qRT-PCR using TaqMan (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline). Gene expression was measured using qRT-PCR using TaqMan (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was isolated using Isolate II RNA Mini Kit (Bioline) and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline) ...
-
bioRxiv - Genomics 2023Quote: ... qPCR was performed using the SensiFAST SYBR NoROX Kit (Bioline) supplemented with 0.2μM of specific primer pairs (Table S9 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Reactions were performed with SensiFAST SYBR Hi-ROX kit (Bioline), and all samples and negative controls were run in technical duplicate on an Applied Bioscience StepOnePlus qPCR machine (Life Technologies).
-
bioRxiv - Neuroscience 2023Quote: ... and reverse transcribed using the SensiFast cDNA Synthesis Kit (Bioline). Quantitative real-time PCR was performed in triplets for each sample using the LightCycler DNA Master SYBR Green I Kit in a LightCycler 480 System (Roche) ...
-
bioRxiv - Cell Biology 2023Quote: ... and cDNA was synthesized using a SensiFast cDNA kit (Bioline) using manufacturer’s instructions from 250 ng of RNA ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA was generated using the Tetro cDNA Synthesis Kit (Bioline) and the Uni12 primer (5’-AGCAAAAGCAGG-3’ ...
-
bioRxiv - Developmental Biology 2024Quote: ... using the Sensifast SYBR no Rox kit (Bioline, BIO-98020). Data analysis and visualisation was performed using Microsoft Excel (Office 365 ...
-
bioRxiv - Cell Biology 2020Quote: ... qPCR was performed using the SensiFAST SYBR No-ROX Kit (Bioline). Primers used to quantify FLOE1 expression were priqPCRFLOE1set1-FWD/REV (Table S3) ...
-
bioRxiv - Immunology 2021Quote: ... Real-time RT-PCR using SensiFast SYBR No-Rox kit (Bioline) was performed to determine gene expression ...
-
bioRxiv - Genetics 2021Quote: ... cDNA was synthesized using the SensiFast cDNA synthesis kit (Bioline, USA), and qPCR was done using the SYBR green mix (Bio-Rad ...
-
bioRxiv - Genetics 2021Quote: ... cDNA was synthesized using the SensiFast cDNA synthesis kit (Bioline, USA), and qPCR was done using the SYBR green mix (Bio-Rad ...
-
bioRxiv - Developmental Biology 2021Quote: RNA was isolated using the ISOLATE II RNA Mini Kit (Bioline) following manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2020Quote: ... The SensiMix SYBR No-ROX kit was from Bioline (London, UK). SmaI was from New England Biolabs (Ipswich ...
-
bioRxiv - Molecular Biology 2021Quote: ... a SensiFAST™ SYBR® No-ROX Kit (Bioline, London, UK) was used to perform the qPCR ...
-
bioRxiv - Molecular Biology 2021Quote: qPCRs were performed using SensiFastTM SYBR® Lo-ROX kit (Bioline). A master mix for each primer pair was prepared following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... and column purified using ISOLATE II RNA Mini Kit (Bioline, Australia) according to the manufacturer’s instruction ...
-
bioRxiv - Immunology 2020Quote: RNA was isolated using the ISOLATE II RNA Mini Kit (Bioline) following the manufacturer’s guidelines ...
-
bioRxiv - Cancer Biology 2019Quote: ... Synthesis of cDNA was performed using Sensifast cDNA Synthesis Kit (Bioline) according to the manufacturer’s instructions ...
-
Virus-mediated transient expression techniques enable genetic modification of Alopecurus myosuroidesbioRxiv - Genetics 2020Quote: ... or Isolate II PCR and Gel Kit (Bioline cat# BIO-52059) according to the manufacturer’s protocols ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... with a MyTaq HS Red Mix PCR kit (Bioline, Eveleigh, Australia). Each 20 μL reaction contained 5 μL of MilliQ water ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was reverse transcribed with the Tetro cDNA synthesis kit (Bioline) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 5 μl of 2X SensiFAST SYBR No-ROX kit (Bioline) in a 10 μl total volume ...
-
bioRxiv - Microbiology 2021Quote: ... Real-time PCR was performed using SensiFAST SYBR & Fluorescein Kit (Bioline) as previously described (25,32) ...
-
bioRxiv - Microbiology 2019Quote: ... with the SensiFAST™ SYBR® No-ROX Kit (Bioline, USA). Reaction mix composition was ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR was performed using SensiFast SYBR Hi-ROX qPCR kit (BioLine). rp49 was used as a housekeeping gene for ΔΔCt calculations ...
-
bioRxiv - Developmental Biology 2020Quote: Total RNA was isolated using Isolate II RNA Mini Kit (Bioline). cDNA was synthesized using SensiFAST cDNA Synthesis Kit (Bioline) ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA synthesis was performed using the Tetro cDNA synthesis kit (Bioline). 2x GoTaq Green master mix (Promega ...
-
bioRxiv - Plant Biology 2021Quote: ... and SensiMix™ SYBR® & Fluorescein Kit (Bioline, Catalog # QT615-05) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... and DNA purification and plasmid isolation kits were obtained from Bioline (Cat#BIO-52060 and Cat#BIO-52057 ...
-
bioRxiv - Microbiology 2019Quote: ... The SensiFAST SYBR Hi-ROX kit (Bioline United Kingdom, BIO-92020) and custom gene-specific primer sets were used to assay 20 ng DNA per reaction for HCMV gB (UL55 ...
-
bioRxiv - Microbiology 2019Quote: ... A SensiFAST Probe No-ROX One-Step Kit (Bioline, NSW, Australia) was used to carry out the gene expression study following the manufacture’s protocol with a Rotor-gene Q Instrument (Qiagen ...
-
bioRxiv - Plant Biology 2020Quote: ... amplification was performed using SensiFAST™ SYBR® & Fluorescein Kit (Bioline) and iQ5 Biorad system ...
-
Increased ACTL6A Occupancy Within mSWI/SNF Chromatin Remodelers Drives Human Squamous Cell CarcinomabioRxiv - Molecular Biology 2021Quote: ... complementary DNA was further synthesized using SensiFAST cDNA synthesis kit (Bioline). cDNAs were mixed with indicated primers and SensiFAST SYBR lo-ROX reagents (Bioline) ...
-
bioRxiv - Neuroscience 2020Quote: ... and cDNA synthesis was performed using Tetro cDNA synthesis kit (Bioline). qPCR was carried out on an Applied Biosystems 7900HT Fast Real-Time PCR system using the SYBR Green method using 1 μl cDNA per triplicate ...
-
bioRxiv - Microbiology 2020Quote: ... in 20μl reactions using the SensiFAST Probe Hi-ROX Kit (Bioline) (cycling conditions ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA was reverse transcribed using the SensiFAST cDNA Synthesis Kit (Bioline) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... or the using Bioline Isolate II Genomic DNA extraction kit (Bioline) following the manufacturer’s protocol and suspended in 50 μL elution buffer ...
-
bioRxiv - Developmental Biology 2020Quote: ... qRT-PCR was performed using SensiMix SYBR low-ROX kit (Bioline) on a QuantStudio5 machine (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2020Quote: ... qPCR was performed using SensiFAST™ SYBR Hi-ROX Kit (Bioline). rp49 was used as a housekeeping gene for ΔCt calculations ...
-
bioRxiv - Molecular Biology 2021Quote: ... or the ISOLATE II RNA Plant kit (Bioline, Meridian Life Science). RNA integrity was confirmed by either agarose gel electrophoresis or by capillary electrophoresis in an Agilent 2100 Bioanalyzer according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries of cDNA were created using SensiFAST cDNA Synthesis Kit (Bioline). Control reactions without reverse transcriptase were conducted to confirm the absence of contaminating DNA in all samples ...
-
bioRxiv - Immunology 2021Quote: ... obtained from the TaqMan RT-PCR kit (Bioline cat# BIO-78005), RT ...
-
bioRxiv - Cell Biology 2022Quote: ... employing SYBR Green chemistry (SensiMix™ SYBR® & Fluorescein Kit, Bioline). PCR reactions contained 2.0 μL diluted cDNA sample (corresponding to 7.5 ng total RNA ...
-
bioRxiv - Immunology 2022Quote: ... obtained from the TaqMan RT-PCR kit (Bioline cat# BIO-78005), was added to a 15 mL tube ...
-
bioRxiv - Molecular Biology 2022Quote: ... RT-qPCR was performed using SensiFAST SYBR No-ROX Kit (Bioline) and 0.3 μM of forward and reverse primers ...