Labshake search
Citations for Bioline :
101 - 150 of 737 citations for Bicinchoninic Acid BCA Protein Assay Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... The SensiFAST SYBR Lo-ROX Kit (Bioline, #BIO-94020) was utilized for the qRT-PCR ...
-
bioRxiv - Plant Biology 2023Quote: ... using SensiFAST SYBR No-ROS kit (Bioline, BIO-98020) following this program ...
-
bioRxiv - Molecular Biology 2023Quote: The Tetro cDNA Synthesis Kit (Bioline; BIO-151 65043) was used to transcribe mRNA into cDNA according to the manufacturer’s manual ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative PCR assays were carried out in the 7500 Real Time PCR System from Applied Biosystems using SensiFAST SYBR Lo-ROX Kit (BioLine, London, UK) and primers previously described [7 ...
-
bioRxiv - Pathology 2024Quote: ... or with a Isolate II RNA Mini Kit (Bioline) as per the manufacturers’ instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... followed by cDNA synthesis (SensiFAST cDNA Synthesis Kit, Bioline). Quantitative real time PCR was performed with PowerUp SYBR Master mix in a QuantStudio 6 Pro system ...
-
bioRxiv - Microbiology 2024Quote: ... SensiFAST SYBR Hi-ROX kit (BIO-92020, Meridian Bioline) was used in the qPCR reactions ...
-
bioRxiv - Plant Biology 2020Quote: ... SYBR Green reaction mix (Bioline; Sensimix SYBR No-ROX kit) was used in a Bio-Rad CFX384 real-time system for qPCR ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR was performed using SensiFast SYBR Hi-ROX kit (Bioline) on CFX96 Touch Real-Time PCR System (Bio-Rad) ...
-
bioRxiv - Immunology 2021Quote: ... obtained from the TaqMan RT-PCR kit (Bioline BIO-78005), was added to a 15 ml tube ...
-
bioRxiv - Genetics 2021Quote: ... and cDNA was prepared with Tetro cDNA Synthesis kit (Bioline). qPCR was performed on Applied Biosystems ViiA™ 7 Real-Time PCR System with Sybr Green ...
-
bioRxiv - Neuroscience 2022Quote: ... or the ISOLATE II RNA Mini Kit (Bioline, BIO-52073). Isolated RNA was reverse transcribed using the SensiFAST cDNA Synthesis Kit (Bioline ...
-
bioRxiv - Molecular Biology 2020Quote: ... For RT-qPCR the SensiFAST SYBR Lo-ROX Kit (Bioline) was used ...
-
bioRxiv - Genomics 2020Quote: ... and converted to cDNA using Tetro cDNA synthesis kit (Bioline) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2020Quote: ... cDNA was transcribed using the SensiFAST cDNA Synthesis Kit (Bioline). Naïve and primed marker expression was determined by qPCR using the Sensifast SYBR No Rox-Kit (Bioline) ...
-
bioRxiv - Cell Biology 2020Quote: ... using the Sensifast SYBR No Rox-Kit (Bioline, BIO-98020). Expression levels were normalized to either L32 or Actin ...
-
bioRxiv - Cell Biology 2020Quote: ... The Sensifast SYBR no-rox Kit (ref. BIO-98005, Bioline) and a Rotor Gene Q Real-Time PCR (Qiagen ...
-
bioRxiv - Bioengineering 2020Quote: ... using the SensiMix™ Kit and SYBRGreen (Bioline, Luckenwalde, Germany). For each triplicate cDNA amounts corresponding to 50 ng RNA were used and measurements were conducted in a LightCycler® 480 (Roche ...
-
bioRxiv - Cancer Biology 2020Quote: ... and SensiMix SYBR No-ROX Kit™ (Bioline, QT650-20), using RPLP0 as a reference gene ...
-
bioRxiv - Cell Biology 2021Quote: ... and the SensiFAST™ SYBR® No-ROX Kit (Bioline), following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNAs were prepared using the SensiFAST cDNA Synthesis Kit (Bioline). Quantitative real-time PCR reactions using cDNA samples as template were carried out using a SensiFAST SYBR No-ROX Kit (Bioline ...
-
bioRxiv - Microbiology 2020Quote: ... Products were purified (Isolate II PCR and Gel kit, Bioline) and Sanger sequenced (Australian Genome Research Facility ...
-
bioRxiv - Cancer Biology 2020Quote: ... qPCRs were run using SensiFAST SYBR No-ROX Kit (Bioline) and a Roche LightCycler 384 ...
-
bioRxiv - Neuroscience 2022Quote: ... and quantitative PCR with the library quantification kit from Bioline Jet Set Library Quantification Kit LoROX (Meridian Bioscience ...
-
bioRxiv - Plant Biology 2021Quote: ... with the SensiMix Kit and SYBR Green (Bioline, Luckenwalde, Germany). Negative controls without template addition ...
-
bioRxiv - Neuroscience 2021Quote: ... 5μl SensiFAST SYBR Green No-ROX Kit (BIOLINE, BIO-98020), and 2μl of DNAse/RNAse-free water ...
-
bioRxiv - Microbiology 2021Quote: ... 125nM) and SensiFAST Probe Hi-ROX One-Step Kit (Bioline) according to the manufacturer’s instructions in a 20μl reaction with 5μl sample ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA preparation was performed using SensiFAST cDNA Synthesis Kit (Bioline) and real-time qPCR was performed using SensiFast SYBR Lo-ROX kit (Bioline) ...
-
bioRxiv - Immunology 2022Quote: ... obtained from the TaqMan RT-PCR kit (Bioline #BIO-78005), was added to a 15 ml tube ...
-
bioRxiv - Microbiology 2020Quote: ... The Sensi-FAST SYBR Hi-ROX One-Step Kit (Bioline) was used for quantitative real time PCR (qRT-PCR) ...
-
bioRxiv - Physiology 2020Quote: ... SensiFAST™ SYBR® Lo-ROX Kit (Bioline, TN, USA) was used to amplify cDNA using primers listed in Table S2 ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was reverse transcribed using SensiFast cDNA Synthesis Kit (Bioline), and SYBR green PCR analysis was performed using Kapa HiFi HotStart Ready Mix (Roche ...
-
bioRxiv - Genomics 2020Quote: RNA was isolated using ISOLATE II RNA Mini Kit (Bioline) according to the manufacturers’ instructions with minor adjustments ...
-
bioRxiv - Microbiology 2021Quote: ... braarudii cells using the Isolate II RNA Mini Kit (Bioline) with on column DNA digestion ...
-
bioRxiv - Microbiology 2021Quote: ... with Sensi-FAST Probe Hi-ROX qPCR kit (Bioline, 82005) (8).
-
bioRxiv - Immunology 2021Quote: ... using the SensiFAST SYBR No-ROX Kit (Bioline, Meridian Bioscience). Hprt1 was used as a housekeeping gene and the standard curve method was used for quantification ...
-
bioRxiv - Developmental Biology 2022Quote: ... purified using ISOLATE II PCR and Gel Kit (Bioline, Australia) and Sanger sequenced at the Australian Genome Resource Facility (AGRF) ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was recovered using a DNA purification kit (Bioline #52060). The binding levels of Gal4 and TBP were determined using qPCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... The protocol used the SensiFAST No-ROX kit (Bioline #98020) and a LightCycler 480 system for detection ...
-
bioRxiv - Microbiology 2022Quote: ... was extracted using genomic DNA extraction kit (Bioline, London, UK) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was synthesized using the SensiFast cDNA synthesis kit (Bioline) and SETD7 and GAPDH levels measured by qPCR were used as positive and negative control respectively ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was reverse transcribed by Tetro cDNA synthesis kit (Bioline) with the primer of ‘GAGCAAAGACCCCAACGAGA’ targeting MBaMV-GFP genome ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative PCR was performed using SensiFAST™ SYBR kit (BIOLINE). The primer sequences used for qPCR are listed in Table S1 ...
-
bioRxiv - Developmental Biology 2024Quote: ... using the Sensifast SYBR no Rox kit (Bioline, BIO-98020). Data analysis and visualisation was performed using Microsoft Excel (Office 365 ...
-
bioRxiv - Immunology 2023Quote: ... RNA was isolated using ISOLATE II RNA Mini Kit (Bioline) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... qPCR was performed using the SensiFAST SYBR NoROX Kit (Bioline) supplemented with 0.2μM of specific primer pairs (Table S9 ...
-
bioRxiv - Cell Biology 2023Quote: ... and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline). Gene expression was measured using qRT-PCR using TaqMan (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline). Gene expression was measured using qRT-PCR using TaqMan (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was isolated using Isolate II RNA Mini Kit (Bioline) and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline) ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA was generated using the Tetro cDNA Synthesis Kit (Bioline) and the Uni12 primer (5’-AGCAAAAGCAGG-3’ ...