Labshake search
Citations for Bioline :
51 - 100 of 797 citations for RNA Amplification kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: RNA was extracted from samples using the ISOLATE II RNA Micro Kit (Bioline, BIO-52075) or the ISOLATE II RNA Mini Kit (Bioline ...
-
bioRxiv - Microbiology 2019Quote: ... Total RNA extraction was performed using the Isolate II RNA Mini Kit (Bioline, NSW, Australia) following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... RNA isolation was carried out using the ISOLATE II RNA Plant kit (Bioline, Meridian, UK) according to the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2024Quote: Snap frozen cell pellets had total RNA extracted using ISOLATE II RNA mini kit (Bioline)
-
bioRxiv - Cancer Biology 2021Quote: RNA was extracted using Isolate II Mini kit (Bioline), following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... using ISOLATE II RNA Mini Kit (Bioline-BIO-52073) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Amplification was carried out in duplicate in 25 µL reactions prepared with 1X SensiFAST™ SYBR® Lo-ROX Kit (Bioline, Meridian Bioscience), 0.4 µL of the forward and reverse primer (IDT ...
-
bioRxiv - Genetics 2019Quote: ... PCR amplification was performed with MyTaq DNA Polymerase (Bioline BIO-21108) and purified with Qiagen QIAquick PCR Purification kit (Qiagen 28104) ...
-
bioRxiv - Genomics 2021Quote: ... PCR amplification of DpnII-digested fragments using MyTaq (Bioline, BIO-21112) enriched for methylated fragments before samples were sonicated and prepped for sequencing ...
-
bioRxiv - Genomics 2021Quote: ... Amplification was performed in duplicate using SYBR green qPCR chemistry (Bioline) using a universal barcode forward primer (F-5’- GCTTGGTTAGAATGGGTAACTAGTTTGCAG-3’ ...
-
bioRxiv - Cancer Biology 2023Quote: Barcode amplification by PCR was performed using 2x Accuzyme mix (Bioline) and 10 ng of the extracted DNA/cDNA using the primers below (10μM):
-
bioRxiv - Evolutionary Biology 2020Quote: ... Total RNA was extracted using a Bioline ISOLATE II RNA Plant Kit (Bioline Ltd, London, UK), following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... total RNA was isolated using the ISOLATE II RNA Mini Kit (BIO-52O72, Bioline, London, UK) according to manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: RNA was extracted from cells seeded on hydrogels using the ISOLATE II RNA Mini Kit (Bioline) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... total RNA was extracted from the attached cells using an RNA Isolate II Mini Kit (BioLine) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: RNA was isolated from cells on with the Isolate II RNA Mini Kit (Bioline, BIO-52702). 1 μg was converted to cDNA with qScript (Quanta ...
-
Quantitative Comparison of Presenilin Protein Expression Reveals Greater Activity of PS2-γ-SecretasebioRxiv - Cell Biology 2023Quote: ... RNA was extracted using ISOLATE II RNA Mini kit as per manufacturer instructions (Bioline BIO-52072) and RNA concentration and quality determined by Nanodrop (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2022Quote: ... or the ISOLATE II RNA Mini Kit (Bioline, BIO-52073). Isolated RNA was reverse transcribed using the SensiFAST cDNA Synthesis Kit (Bioline ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was reverse transcribed using SensiFast cDNA Synthesis Kit (Bioline), and SYBR green PCR analysis was performed using Kapa HiFi HotStart Ready Mix (Roche ...
-
bioRxiv - Physiology 2019Quote: ... reagent and ISOLATE II RNA Mini kit (Bioline, #BIO-52073). Isolated RNA was reverse transcribed using iScript cDNA Synthesis Kit (Biorad ...
-
bioRxiv - Microbiology 2021Quote: ... braarudii cells using the Isolate II RNA Mini Kit (Bioline) with on column DNA digestion ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was reverse transcribed by Tetro cDNA synthesis kit (Bioline) with the primer of ‘GAGCAAAGACCCCAACGAGA’ targeting MBaMV-GFP genome ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was isolated from at least 10 midguts using the Isolate II RNA Mini kit (Bioline, UK). The extracted RNA was quantified using Nanodrop (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... Total RNA was isolated from sorted cells using the Isolate II RNA mini kit (Bioline, London, UK) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was extracted from MSCs and OA-HSFs using the Isolate II RNA Micro Kit (Bioline, Canada) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... meristems were snap-frozen and total RNA was extracted using Isolate II RNA plant kit (Bioline, UK). RNA-sequencing libraries were synthesised for each sample using NEBNext Ultra II stranded RNA library synthesis kits ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was extracted from PCa cells using the Isolate II RNA Mini Kit (Bioline, London, UK) and was reverse transcribed to cDNA using the SensiFastTM cDNA synthesis kit (Bioline ...
-
bioRxiv - Plant Biology 2020Quote: Gene and promoter amplification were performed using MyFi™ DNA Polymerase (Bioline). FvMYB10-gypsy and Fvb1 FIN12 genomic fragments flanking the deleted region were both amplified with 5Prime PCR Extender System (5Prime ...
-
bioRxiv - Immunology 2020Quote: ... 5 - 10 ng DNA was used for amplification with MyTaq Polymerase (Bioline). The PCR cycling conditions were as follows ...
-
bioRxiv - Molecular Biology 2021Quote: ... The amplification was performed in 25 µl containing Biomix reaction mix (Bioline) and ultra-stable Taq DNA polymerase (Bioline) ...
-
bioRxiv - Genomics 2021Quote: ... qPCR amplification was performed in triplicate with SYBR green qPCR chemistry (Bioline) using primers for Tnfa (F-5’- ACCTCACACTCAGATCATCTTCTC-3’ ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR amplifications were carried out using the SensiFast SYBR Lo-Rox (Bioline) mix and they were monitored in real time with a 7500 Real Time PCR System (Applied Biosystems) ...
-
bioRxiv - Genomics 2023Quote: ... PCR amplification was then performed using 1U MyTaq HS DNA Polymerase (BioLine) in 1× MyTaq buffer ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was extracted from treated cells via an ISOLATE II RNA mini kit (Bioline, Cat: BIO-52073) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was synthesised using SuperScript III reverse transcriptase from RNA extracted using ISOLATE II RNA Mini Kit (Bioline) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: Isolation of total RNA and cDNA synthesis was performed by using the Isolate II RNA Mini Kit (Bioline) and SensiFAST cDNA Synthesis Kit (Bioline) ...
-
bioRxiv - Genomics 2020Quote: ... and column purified using ISOLATE II RNA Mini Kit (Bioline, Australia) according to the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was reverse transcribed with the Tetro cDNA synthesis kit (Bioline) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA was reverse transcribed using the SensiFAST cDNA Synthesis Kit (Bioline) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... or the ISOLATE II RNA Plant kit (Bioline, Meridian Life Science). RNA integrity was confirmed by either agarose gel electrophoresis or by capillary electrophoresis in an Agilent 2100 Bioanalyzer according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA was reverse transcribed with SensiFAST cDNA Synthesis Kit (Bioline) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2019Quote: ... PCR amplification was performed in 25µl volumes with 2Χ Ready-mix (Bioline, UK) (volume 12.5µl ...
-
bioRxiv - Zoology 2021Quote: ... PCR amplification was performed using 12.5 µL of MyTaq HS Mix (Bioline, US) hot-start polymerase ...
-
bioRxiv - Immunology 2022Quote: RNA was isolated from lung and blood using Isolate II RNA mini kit protocol (Bioline Reagents Ltd., London, UK) with slight modification ...
-
bioRxiv - Immunology 2021Quote: RNA was isolated from lung and blood using Isolate II RNA mini kit protocol (Bioline Reagents Ltd., London, UK) with slight modification ...
-
bioRxiv - Genetics 2023Quote: RNA was isolated from cells with Isolate II RNA Mini Kit according to the manufacturer’s instructions (Bioline, BIO-52702). 1 μg of RNA was converted to cDNA using qScript (Quanta ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was reverse transcribed to cDNA using SensiFAST cDNA synthesis kit (Bioline). The cDNA was diluted 1:5 with nuclease free water and 5 μL were used per qPCR reaction ...
-
bioRxiv - Developmental Biology 2020Quote: ... cDNA was transcribed using 1µg RNA and sensiFAST cDNA Synthesis Kit (Bioline) following the instructions of the manufacturer.
-
bioRxiv - Microbiology 2019Quote: ... and RNA was reverse-transcribed into cDNA (Bioline Tetro cDNA synthesis kit). cDNA samples were used for qPCR (Bioline SensiFAST SYBR and Flourescein kit ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was reverse transcribed using the SensiFast cDNA Synthesis Kit (Bioline), and quantitative real-time PCR was performed using the LightCycler DNA Master SYBR Green I Kit in a LightCycler 480 System (Roche) ...