Labshake search
Citations for Bioline :
901 - 950 of 951 citations for hsa mir 33a 3p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... 1 μl of the dilution was mixed with 0.41 μM primers (Supplemental Table S4) and 1x Sensifast SYBR non-Rox kit (Bioline Bio98005). The real-time PCR program cycled as follows ...
-
bioRxiv - Cancer Biology 2023Quote: ... Isolated RNA (0.5-1 µg) was then used for reverse transcription into first strand cDNA via a SensiFast cDNA synthesis kit (Bioline). RNA spike I (TATAA ...
-
bioRxiv - Evolutionary Biology 2022Quote: qPCR was performed on each of the samples using an Applied Biosystems StepOnePlus system with a Sensifast Hi-Rox Sybr kit (Bioline). Cycle conditions were as follows ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... qRT-PCR was carried out on 1:2 diluted cDNA on an Applied Biosystems StepOnePlus system using a Sensifast Hi-Rox SYBR kit (Bioline). Cycle conditions were as follows ...
-
bioRxiv - Evolutionary Biology 2023Quote: The relative quantity of the reverse transcribed target cDNA was assessed using magnetic induction cycler (micPCR, Bio Molecular Systems) and SensiFAST SYBR Lo-ROX Kit (Bioline). For each gene ...
-
bioRxiv - Microbiology 2023Quote: ... 0.2 ml chloroform was added for phase separation using phase lock gel heavy tubes and RNA isolation from the aqueous phase was obtained by using ISOLATE II RNA Mini Kit (Bioline). RNA quality was verified with Agilent 2100 Bioanalyzer System using RNA Nano Chips (Agilent Technologies) ...
-
bioRxiv - Microbiology 2023Quote: ... was performed in technical triplicate with 50 ng of cDNA per reaction using the SensiFAST SYBR & Fluorescein Kit from Bioline, on a Roche Lightcycler 96 ...
-
bioRxiv - Neuroscience 2023Quote: ... or 1 μg (4 weeks of treatment) of the total RNA was reverse-transcribed into cDNA using a Tetro cDNA synthesis kit (BIO-65042, Bioline). Quantitative PCR (RT-qPCR ...
-
bioRxiv - Microbiology 2023Quote: ... 0.2 ml chloroform was added for phase separation using phase lock gel heavy tubes and RNA isolation from the aqueous phase was obtained by using ISOLATE II RNA Mini Kit (Bioline). RNA quality was verified with Agilent 2100 Bioanalyzer System using RNA Nano Chips (Agilent Technologies) ...
-
bioRxiv - Microbiology 2023Quote: ... The reactions (10 μL total volume) contained 5 μL of 2 × SensiFAST™ SYBR No-ROX Kit (Bioline, London, UK), 0.2 μM of each arsM gene primer ...
-
bioRxiv - Cell Biology 2023Quote: ... 150 ng of total RNA was converted to complementary DNA (cDNA) using SensiFASTTM cDNA synthesis kit following manufacturer instructions (Bioline) and qPCR performed using SensiFAST™ SYBR® Lo-ROX Kit following manufacturer instructions (Bioline) ...
-
bioRxiv - Neuroscience 2024Quote: ... 150 ng of total RNA was converted to complementary DNA (cDNA) using SensiFASTTM cDNA synthesis kit following manufacturer instructions (Bioline) and qPCR performed in technical triplicate using SensiFAST™ SYBR® Lo-ROX Kit following manufacturer instructions (Bioline ...
-
bioRxiv - Microbiology 2021Quote: ... Each reaction (20 μL) consisted of 1 μL of cDNA substrate and 19 μL of a SensiFAST No-ROX Kit Master Mix (Bioline, UK). Following primer optimisation ...
-
bioRxiv - Genetics 2019Quote: ... cDNA was diluted in nuclease-free water and stored at −20°C until used in qPCR with the SensiFastTM SYBR® No-ROX kit (Bioline) and a Lightcycler® 480/1536 (Roche ...
-
bioRxiv - Genomics 2020Quote: ... total RNA of both uninfected and DENV1-infected samples were subjected cDNA synthesis using Tetro cDNA synthesis kit (Bioline, BIO-65042). Reverse oligo of DENV1 specific primer was used in cDNA synthesis ...
-
bioRxiv - Neuroscience 2020Quote: ... Reverse transcription of 500 ng of motor cortex RNA was performed using the Tetro cDNA Synthesis kit (Bioline, Meridian Bioscience, USA) with random hexamer primers according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... genomic DNA (gDNA) was isolated from mouse brains or dural meninges using the Isolate II Genomic DNA Kit (Bioline, BIO-52067) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: DNA was isolated from whole adult BF and HIE-18 cells using an Isolate II Genomic DNA kit (Bioline, NSW, Australia) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... the cells were collected and genomic DNA was extracted using the ISOLATE II Genomic DNA kit (Bioline cat. no. BIO-52067). PCR was performed in two steps and pooled experiments were performed in triplicates for a higher coverage ...
-
bioRxiv - Microbiology 2020Quote: Bacterial cultures were grown in Luria Bertani (LB) broth for 18-24h at 37 °C and DNA was extracted using the Isolate II Genomic DNA Kit (Bioline, UK) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The number of mycobacterial cells in the sample was quantified using the SensiFAST SYBR No-ROX qPCR kit (Bioline, London, UK) on bacterial DNA according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was then synthesized from 2.5 μg RNA in a 20 μL reaction using both random hexamers and oligo(dT) primers provided with the Tetro cDNA Synthesis kit (Bioline™). Ten defense genes were quantified using the SYBR Green qRT-PCR kit on a ViiA™ 7 sequence detection system ...
-
bioRxiv - Immunology 2023Quote: ... The total qPCR reaction volume was 1.5 μl and consisted of 0.5 μl of cDNA (dilution 1/12) and 1 μl of SensiFAST™ SYBR® No-ROX Kit (Bioline) containing 0.4 μM of PCR primer (Eurogenetec SA)(primer list in sup ...
-
bioRxiv - Genetics 2024Quote: RT-qPCR was performed (in triplicate) using the Bio-Rad cycler CFX 96 and the SensiFAST SYBR Green Kit (Catalog Number BIO-98005, BIOLINE, USA). Gene expression levels were normalized to housekeeping genes pmp-3 ...
-
bioRxiv - Microbiology 2020Quote: ... 250-1,000 ng of extracted RNA was converted to cDNA in a reaction volume of 20 μl using the Tetro cDNA synthesis kit (BIO-65043, Bioline, London, UK). The cDNA was then amplified using an SYBR green RT-PCR kit (06924204001 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and mClover3-bElys constructs were cloned from bovine fibroblast or bovine oocyte cDNA libraries made using a SensiFAST cDNA synthesis kit (Bioline, BIO-65053). The primers (KASH5-DN cloning ...
-
bioRxiv - Molecular Biology 2021Quote: ... and one μg of total RNA from each sample was converted into cDNA with SensiFAST™ cDNA Synthesis Kit (Bioline, London, UK) using a T100™ Thermal Cycler (Bio-Rad ...
-
bioRxiv - Genetics 2020Quote: ... 100 ng of sonicated template was used for T7-mediated IVT using the MEGAscript T7 Transcription Kit (ThermoFisher #AMB13345, supplemented with Ribosafe RNAse Inhibitor (Bioline #BIO-65028)) ...
-
bioRxiv - Genomics 2020Quote: ... DNA was extracted using the NucliSENS® EasyMag® (BioMérieux, Marcy l’Etoile, France) or the Isolate II Genomic DNA kit (Bioline, Tennessee, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... we used a primer concentration of 500 nM in a final volume of 10 μl with the SensiFast SYBR No-ROX Kit (Bioline, London, UK). The amplification conditions were as follows ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA was prepared from 300 ng of RNA in a total reaction volume of 20 µl using the Sensi-FAST cDNA synthesis kit (Bioline, BIO-65053). RT-PCR reactions were set up in a 384-well format using 2X SensiFAST Probe No-ROX Kit (Bioline ...
-
bioRxiv - Microbiology 2020Quote: ... the qPCR analysis was performed on each DNA sample in duplicates by using SensiFAST™ SYBR® No-ROX Kit (Bioline, UK) and primer sets summarised in table 2 at a final concentration of 1 pM of each primer ...
-
bioRxiv - Cancer Biology 2020Quote: ... SK-MEL-147 and SK-MEL-23 melanoma cells expressing either sgCtrl or sgSTUB1 was isolated using the Isolate II RNA Mini Kit (Bioline, BIO-52072) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: DNA was extracted from whole female BF post adult and pupal injection using an Isolate II Genomic DNA extraction kit (Bioline, NSW, Australia). Six flies were assayed at each point of time for determination of the relative Wolbachia density ...
-
bioRxiv - Cell Biology 2022Quote: ... 750 ng total RNA was reverse transcribed to form cDNA according to the manufacturer’s protocol (SensiFAST™ cDNA Synthesis Kit, Bioline, Luckenwalde, Germany). Real-time PCR analyses were performed on a MyiQ Single-Color Real-Time PCR detection system (Bio-Rad ...
-
bioRxiv - Cell Biology 2022Quote: ... 750 ng total RNA was reverse transcribed to form cDNA according to the manufacturer’s protocol (SensiFAST™ cDNA Synthesis Kit, Bioline, Luckenwalde, Germany). Real-time PCR analysis was performed according to the manufacturer’s protocol (SensiMix™ SYBR® & Fluorescein Kit ...
-
bioRxiv - Synthetic Biology 2022Quote: Up to 900 ng of RNA was used per sample to synthesise cDNA using the SensiFAST cDNA Synthesis kit (Bioline, #BIO-65054) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... the aqueous phase was mixed 1:1 v/v with 70% ethanol and loaded into a column of the Isolate II RNA Mini kit (Bioline, Cincinnati, OH). Total RNA was purified following the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2023Quote: ... The samples were collected 72 hours after the addition of the drugs and genomic DNA (gDNA) was extracted using the ISOLATE II genomic DNA kit (Bioline, BIO-52067). The samples were then quantified using Nanodrop and 200 ng of gDNA was used in the library PCRs that were performed as for the screening above ...
-
bioRxiv - Cancer Biology 2023Quote: The isolation of total RNA and its conversion to cDNA were performed using the ISOLATE II RNA Mini Kit (Bioline, BIO-52073) and the qScript cDNA synthesis kit (Quanta Bioscience ...
-
bioRxiv - Immunology 2022Quote: ... Purified nucleic acid was then immediately converted to cDNA by reverse transcription with random hexamers using the SensiFAST cDNA Synthesis Kit (Bioline Reagents, UK) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 ng of the total RNA was reverse-transcribed into cDNA using a Tetro cDNA synthesis kit (BIO-65042, Bioline, London, UK). Quantitative PCR (RT-qPCR ...
-
bioRxiv - Immunology 2024Quote: Parasite genomic DNA was isolated from mouse peritoneal exudate cells and whole brain using the Isolate II Genomic DNA Kit (Bioline, BIO-52067). Prior to isolation ...
-
bioRxiv - Cell Biology 2024Quote: RNA from cell pellets treated with dTAG-13 for four hours was isolated using the Isolate II RNA Mini Kit (Bioline BIO-52072), and 1 μg was converted to cDNA using the qScript cDNA Synthesis Kit (VWR 101414) ...
-
bioRxiv - Cell Biology 2021Quote: ... 500 ng of total RNA from each sample were reverse transcribed to cDNA using the Bioline SensiFAST cDNA Synthesis kit (Bioline, Cat# BIO-65054). The cDNA was diluted 13-fold in ddH2O and 4 uL of this dilution was used for each quantitative real-time PCR (qPCR) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Amplification was carried out in duplicate in 25 µL reactions prepared with 1X SensiFAST™ SYBR® Lo-ROX Kit (Bioline, Meridian Bioscience), 0.4 µL of the forward and reverse primer (IDT ...
-
bioRxiv - Plant Biology 2023Quote: ... A total of 1 µg of total RNA was used to initiate cDNA synthesis using the SensiFAST™ cDNA Synthesis Kit (Bioline, London, UK). The SYBR Green assay with SensiFAST™ SYBR no ROX kit was used for the quantification of transcripts in RT-PCR ...
-
bioRxiv - Genetics 2022Quote: ... The Endpoint PCR amplification (gDNA concentration of 20-50 ng μl−1 per sample) for each target region were performed using MyFi™ DNA Polymerase Kit (Bioline GmbH, Luckenwalde, Germany) and specific primers (IDENTXX GmbH)in a PCR thermal cycler (T100 PCR thermal cycler ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA was synthesized by reverse transcribing 500ng of RNA into cDNA using the SensiFAST™ cDNA Synthesis Kit (Bioline, Meridian Life Science© Company). Quantitative PCR was performed on 6,25ng of cDNA using the SensiFAST™ SYBR® No-ROX kit (Bioline ...
-
bioRxiv - Physiology 2021Quote: ... was performed with three primers (Figure 1 A, “a”: AAGGCGCATAACGATACCAC, “b”: TACAATGCAGGCTCCAAACAC, “c”: CGAGCACAGGAAGTTCAACA, Eurofins Genomics, Ebersberg/Germany) and the ImmoMix™ kit (Bioline, Cat. No BIO-25020) according to the manufacturer’s instructions.