Labshake search
Citations for Bioline :
701 - 742 of 742 citations for Urea Nitrogen Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... DNA was extracted using the NucliSENS® EasyMag® (BioMérieux, Marcy l’Etoile, France) or the Isolate II Genomic DNA kit (Bioline, Tennessee, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... The final PCR primer concentration was 500 nM in a volume of 10 μl with the SensiFast SYBR No-ROX Kit (Bioline, London, UK). The following amplification program was used ...
-
bioRxiv - Microbiology 2020Quote: ... we used a primer concentration of 500 nM in a final volume of 10 μl with the SensiFast SYBR No-ROX Kit (Bioline, London, UK). The amplification conditions were as follows ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA was prepared from 300 ng of RNA in a total reaction volume of 20 µl using the Sensi-FAST cDNA synthesis kit (Bioline, BIO-65053). RT-PCR reactions were set up in a 384-well format using 2X SensiFAST Probe No-ROX Kit (Bioline ...
-
bioRxiv - Cancer Biology 2020Quote: Real-time RT-PCR reactions were performed in 20ml volumes with 10 ml of SensiFAST SYBR Lo-ROX Kit (Bioline, Taunton, MA) 2ml of cDNA template and 0.5ml each of the forward and reverse primers of the gene of interest (GOI) ...
-
bioRxiv - Microbiology 2020Quote: ... the qPCR analysis was performed on each DNA sample in duplicates by using SensiFAST™ SYBR® No-ROX Kit (Bioline, UK) and primer sets summarised in table 2 at a final concentration of 1 pM of each primer ...
-
bioRxiv - Cell Biology 2019Quote: ... The cDNA was then diluted 1:5 and qRT-PCR reactions were set up in triplicate using primers synthesized from IDT and SensiMix SYBR & Fluorescin kit (Bioline, Meridian Bioscience). qRT-PCR was done using a Corbett Research RG 6000 thermocycler ...
-
bioRxiv - Cancer Biology 2020Quote: ... SK-MEL-147 and SK-MEL-23 melanoma cells expressing either sgCtrl or sgSTUB1 was isolated using the Isolate II RNA Mini Kit (Bioline, BIO-52072) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... a real-time PCR using described primers26 and the SensiFast probe no ROX kit was performed according to supplier recommendations (Bioline GmbH, Germany). DNA from formalin-fixed tissues was extracted by using the QIAamp DNA FFPE Tissue Kit (QIAGEN) ...
-
bioRxiv - Biochemistry 2021Quote: ... Quantitation of the OP91 transcript was done by quantitative PCR using the SensiFAST SYBR® Hi-ROX Kit (Bioline, Memphis, TN, USA) and the StepOnePlus™ Real-Time PCR detection system (Applied biosystems by Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2019Quote: DNA was extracted from whole female BF post adult and pupal injection using an Isolate II Genomic DNA extraction kit (Bioline, NSW, Australia). Six flies were assayed at each point of time for determination of the relative Wolbachia density ...
-
bioRxiv - Cell Biology 2022Quote: ... 750 ng total RNA was reverse transcribed to form cDNA according to the manufacturer’s protocol (SensiFAST™ cDNA Synthesis Kit, Bioline, Luckenwalde, Germany). Real-time PCR analyses were performed on a MyiQ Single-Color Real-Time PCR detection system (Bio-Rad ...
-
bioRxiv - Cell Biology 2022Quote: ... 750 ng total RNA was reverse transcribed to form cDNA according to the manufacturer’s protocol (SensiFAST™ cDNA Synthesis Kit, Bioline, Luckenwalde, Germany). Real-time PCR analysis was performed according to the manufacturer’s protocol (SensiMix™ SYBR® & Fluorescein Kit ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Amplicons of the appropriate size range for the transgene of interest were then gel extracted for nanopore sequencing using the ISOLATE II PCR and Gel Kit (Bioline, #BIO-52060) (Figure S5).
-
bioRxiv - Synthetic Biology 2022Quote: Up to 900 ng of RNA was used per sample to synthesise cDNA using the SensiFAST cDNA Synthesis kit (Bioline, #BIO-65054) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: Parasite genomic DNA was isolated from mouse peritoneal exudate cells and whole brain using the Isolate II Genomic DNA Kit (Bioline, BIO-52067). Prior to isolation ...
-
bioRxiv - Cell Biology 2024Quote: RNA from cell pellets treated with dTAG-13 for four hours was isolated using the Isolate II RNA Mini Kit (Bioline BIO-52072), and 1 μg was converted to cDNA using the qScript cDNA Synthesis Kit (VWR 101414) ...
-
bioRxiv - Genomics 2023Quote: ... The samples were collected 72 hours after the addition of the drugs and genomic DNA (gDNA) was extracted using the ISOLATE II genomic DNA kit (Bioline, BIO-52067). The samples were then quantified using Nanodrop and 200 ng of gDNA was used in the library PCRs that were performed as for the screening above ...
-
bioRxiv - Immunology 2023Quote: ... the aqueous phase was mixed 1:1 v/v with 70% ethanol and loaded into a column of the Isolate II RNA Mini kit (Bioline, Cincinnati, OH). Total RNA was purified following the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: The isolation of total RNA and its conversion to cDNA were performed using the ISOLATE II RNA Mini Kit (Bioline, BIO-52073) and the qScript cDNA synthesis kit (Quanta Bioscience ...
-
bioRxiv - Immunology 2022Quote: ... Purified nucleic acid was then immediately converted to cDNA by reverse transcription with random hexamers using the SensiFAST cDNA Synthesis Kit (Bioline Reagents, UK) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 ng of the total RNA was reverse-transcribed into cDNA using a Tetro cDNA synthesis kit (BIO-65042, Bioline, London, UK). Quantitative PCR (RT-qPCR ...
-
bioRxiv - Cell Biology 2021Quote: ... 500 ng of total RNA from each sample were reverse transcribed to cDNA using the Bioline SensiFAST cDNA Synthesis kit (Bioline, Cat# BIO-65054). The cDNA was diluted 13-fold in ddH2O and 4 uL of this dilution was used for each quantitative real-time PCR (qPCR) ...
-
bioRxiv - Molecular Biology 2021Quote: Ear biopsies from 21 days old mice were digested in MyTaq Extract PCR kit according to the manufacturer (Bioline, Cat number BIO-21126). PCR amplification was performed using the high-fidelity enzyme Q5 from New England Biolab (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... Amplification was carried out in duplicate in 25 µL reactions prepared with 1X SensiFAST™ SYBR® Lo-ROX Kit (Bioline, Meridian Bioscience), 0.4 µL of the forward and reverse primer (IDT ...
-
bioRxiv - Genomics 2021Quote: ... One-step reverse-transcription quantitative PCR (RT-qPCR) was performed with the SensiFAST™ SYBR® No-ROX One-Step kit (Bioline®) on an Eco™ Real-Time PCR System (Ilumina® ...
-
bioRxiv - Plant Biology 2024Quote: ... cDNAs were diluted to 50 µL and used as template for Real-Time PCR monitored by SensiFast SYBR No-Rox Kit (Bioline, Cincinatti, OH, USA). RT-PCR was performed in the Roche Light Cycler 480 using primers for CAH4 ...
-
bioRxiv - Immunology 2023Quote: ... Quantitative PCRs (qPCRs) were performed on cDNA samples using SensiFAST™ SYBR® Hi-ROX or SensiFAST™ Probe No-ROX kits (Bioline) on a StepOnePlus real-time PCR apparatus (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative PCR was performed on 6,25ng of cDNA using the SensiFAST™ SYBR® No-ROX kit (Bioline, Meridian Life Science© Company) and a LightCycler® 480 Detection system (Roche) ...
-
bioRxiv - Plant Biology 2023Quote: ... A total of 1 µg of total RNA was used to initiate cDNA synthesis using the SensiFAST™ cDNA Synthesis Kit (Bioline, London, UK). The SYBR Green assay with SensiFAST™ SYBR no ROX kit was used for the quantification of transcripts in RT-PCR ...
-
bioRxiv - Molecular Biology 2019Quote: ... qRT-PCR was carried out with specific primer sets (listed in Supplementary Table 10) using SensiFAST™ SYBR® No-ROX Kit (BIOLINE, BIO-98005) and CFX Connect Real-Time PCR Detection System (BIO-RAD ...
-
bioRxiv - Microbiology 2021Quote: The origin of viral genes present in samples were determined by gene-specific reverse transcription polymerase chain reaction (RT-PCR) using a SensiFast Probe No-ROX one-step reverse transcription kit (Bioline, Meridian Biosciences, Ohio, USA). Each 20 µL reaction contained 5 μl of virus sample in 0.05% Triton-X 100 ...
-
bioRxiv - Genetics 2022Quote: ... The Endpoint PCR amplification (gDNA concentration of 20-50 ng μl−1 per sample) for each target region were performed using MyFi™ DNA Polymerase Kit (Bioline GmbH, Luckenwalde, Germany) and specific primers (IDENTXX GmbH)in a PCR thermal cycler (T100 PCR thermal cycler ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR amplicon band was cut from the gel and isolated by PCR Isolate II PCR and Gel Kit (Bioline, cat. no. BIO-52060) and lastly bead-purified ...
-
bioRxiv - Genomics 2023Quote: ... The PCR product was cut from gel to remove any other undesired products and cleaned with the PCR Isolate II PCR and Gel Kit (Bioline, cat. no. BIO-52060). The isolated samples were sequenced by Illumina MiSeq for screen 1 (14.3 million reads ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA was synthesized by reverse transcribing 500ng of RNA into cDNA using the SensiFAST™ cDNA Synthesis Kit (Bioline, Meridian Life Science© Company). Quantitative PCR was performed on 6,25ng of cDNA using the SensiFAST™ SYBR® No-ROX kit (Bioline ...
-
bioRxiv - Cell Biology 2024Quote: ... HTLV-2 and microbial contaminants and by us for the absence of mycoplasma using EZ-PCR Mycoplasma Test kit (Biological Industries; #20-700-20) and the HyperLadderTM 1kb (Bioline/Meridian Bioscience; # BIO-33026).
-
bioRxiv - Neuroscience 2019Quote: A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...
-
bioRxiv - Physiology 2021Quote: ... was performed with three primers (Figure 1 A, “a”: AAGGCGCATAACGATACCAC, “b”: TACAATGCAGGCTCCAAACAC, “c”: CGAGCACAGGAAGTTCAACA, Eurofins Genomics, Ebersberg/Germany) and the ImmoMix™ kit (Bioline, Cat. No BIO-25020) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: ... Gene expression analysis was performed by quantitative real time PCR (qRT-PCR) with SensiFAST™ SYBR® Lo-ROX Kit (Bioline Reagents Ltd., London, UK) run on the QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Immunology 2021Quote: ... Gene expression analysis was performed by quantitative real time PCR (qRT-PCR) with SensiFAST™ SYBR® Lo-ROX Kit (Bioline Reagents Ltd., London, UK) run on the QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2020Quote: ... The data presented in this study represents serological diagnosis using rapid test kit (SD Bioline dengue IgG/IgM antibody up to 2015; and after 2015, SD Bioline dengue duo (dengue NS1 Ag+ IgG/IgM), Korea ...